1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
3 years ago
10

Describe the role you of the nucleus in the cell

Biology
1 answer:
Lerok [7]3 years ago
5 0

The nucleus is an organelle found in eukaryotic cells. Inside its fully-enclosed nuclear membrane, it contains the majority of the cell's genetic material. This material is organized as DNA molecules, along with a variety of proteins, to form chromosomes.

You might be interested in
A population of 120 rabbits lives in a prairie ecosystem. Which of these might prevent this population from growing any larger?
natita [175]
 The prairie would become overpopulated and there would be no more food for the rabbits and they would eventually die. 
7 0
3 years ago
Read 2 more answers
Newton's laws of motion are not used to describe what happens when an object
Elenna [48]

Answer:

Gets caught on fire

Explanation:

took the test

3 0
3 years ago
Read 2 more answers
When an employee remembers the first manager who came and spoke to them on their first day of work, the event is most likely to
Svetllana [295]

Episodic Memory!

Episodic memory includes personal information on what happened and where.

Hope this helps!

6 0
2 years ago
In the skeletal system which are the two main tissue is responsible for structural support in the body
Anettt [7]
I believe it would be Bone Tissue and Connective Tissue
8 0
3 years ago
Read 2 more answers
All animals are _______.
Sophie [7]
Consumers. Obviously all animals are not b or c as there are animals that are both. Plants are producers as they produce energy, and animals consume the energy making them consumers. 
7 0
3 years ago
Read 2 more answers
Other questions:
  • EXPLAIN PLEASE The male pom-pom monkey of the island of Hoi Polloi has evolved to have long bright puffs of turquoise fur all ar
    8·1 answer
  • Is the formation of a new species from an existing species and can occur in two phases.
    12·2 answers
  • What are the inputs and outputs of each stage of photosynthesis and cellular respiration?
    15·1 answer
  • Used fuel assemblies are typically considered _______. a. low-level waste b. uranium mill tailing c. high-level waste d. all of
    9·2 answers
  • Compare your results with those of other groups. How did the seeds respond to the temperature?(cold and room temperature) infer
    15·1 answer
  • What is a radical in biology ?? ​
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please help me, I attached the question because it has a picture for the question. help ASAP
    10·1 answer
  • Scientists use a ______ to detect and study earthquake waves. Two types of Earthquake waves that travel through Earth’s interior
    10·2 answers
  • Which of the following is an example of an ecosystem? male prairie chickens competing for access to mates flowering plants and a
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!