1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
15

If a sample of DNA contains 20% C nucleotides, what percent of G nucleotides would there be. Explain

Biology
2 answers:
Licemer1 [7]3 years ago
7 0

Answer:

The perecentage of guanine is 30%

Explanation:

the DNA from any cell of all organisms should have a 1:1 ratio (base Pair Rule) of purine bases [for the DNA cytosine, thymine and for the RNA uracil] and pyrimidine bases [guanine and adenine for RNA and DNA]. The amount of guanine should be equaled to cytosine and the amount of adenine should be equaled to thymine. You can follow this rule in both strands of the DNA.

Delicious77 [7]3 years ago
6 0

Answer:

The perecentage of guanine is 30%

Explanation:

Hope this helps!!!

Forever friend and helper,

Cammie:)

You might be interested in
Chen draws a diagram to show water changing from a liquid to water vapor. Complete the sentences. _______All the water molecules
romanna [79]

kinetic energy is needed by the molecules in order to escape from the surface.

All the water molecules in the liquid are moving randomly due to the presence of some energy in it. Some of the molecules have more kinetic energy due to absorption of heat energy from the surrounding environment.

Due to high kinetic energy, these molecules move enough to escape the surface of the liquid. This is called boiling point. This makes the liquid become gas so we can conclude that kinetic energy is needed by the molecules in order to escape from the surface.

Learn more about boiling point here: brainly.com/question/40140

Learn more: brainly.com/question/25893146

5 0
2 years ago
Explain why all mutations are not necessarily harmful.
riadik2000 [5.3K]
Some mutations in living species help them to adapt and help protect them from predtors
5 0
3 years ago
Read 2 more answers
Why do myosin filaments have club-shaped heads?
Arturiano [62]
The answer is the heads are where acetylcholine binds to initiate contraction
8 0
3 years ago
Science: An animal without a backbone is called A.) A vertebrate B.) An invertebrate C.) A chordate D.) An endotherm
andreev551 [17]

The answer would be B) Sponges, corals, worms, insects, spiders and crabs are all sub-groups of the invertebrate.


6 0
3 years ago
What molecule can mix with water and i also a source of energy and a storage area?
elena-s [515]
Atp

it’s a form of energy
6 0
3 years ago
Read 2 more answers
Other questions:
  • A 20-year-old male is hospitalized with a 4-day history of cough and a temperature of 41°c. chest sounds are dull to percussion.
    8·1 answer
  • In what ways is the evolution of a massive
    6·1 answer
  • The bee is pollinating the flower. This is an important step in the ____________ of flowering plants.
    14·2 answers
  • Griffith's experiments with s. pneumoniae were significant because they showed that traits could be transferred from one organis
    8·1 answer
  • the natural balance between. pray and predator has been increasingly -----, usually because of the human intervention. a, recogn
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Of the elements chonps, which is NOT found in DNA?
    8·1 answer
  • Please Help! Due Today!
    14·2 answers
  • Which of the following accurately describes where glyphosate can be used and why
    11·1 answer
  • Two linebackers tackle a quarterback. One hit him with a force of 105 N and the other hit him with a force of 150 N. They are bo
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!