1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vivado [14]
3 years ago
13

What is the impact of the rabbit to the ecosystem ?

Biology
2 answers:
Ber [7]3 years ago
5 0
A rabbit is the primary consumer. Without the rabbit, secondary consumers will  starve and die off and/or will begin to compete with other secondary consumers for food. 
fredd [130]3 years ago
4 0
Farms productivey and native ecosystem
You might be interested in
How does aero and anaerobic respreastion differ
saveliy_v [14]
Aerobic respiration takes place in the mitochondria and requires oxygen and glucose, and produces carbon dioxide, water, and energy.

anaerobic respiration also produces energy and uses glucose but it produces less energy and does not require oxygen.
3 0
3 years ago
The air pollution in your area is increasing by the day. What would be the most appropriate way to address this problem?
Juli2301 [7.4K]

Answer:

hope it helps you!!!!!!

4 0
3 years ago
Are reactants in the process of cell reception
Otrada [13]

Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.Yes.

6 0
3 years ago
Flock X Flock Y Flock Z Total Pieces of Food Eaten 57 153 90 Food Percentage* % % % Simulated Number of Birds in Flock for 2nd G
Zepler [3.9K]

Answer: The percentage would be 19%, 51% and 30%.

Explanation:

Since we have given that

Number of food eaten by X = 57

Number of food eaten by Y = 153

Number of food eaten by Z = 90

Total number of food eaten = 57+153+90=300

So, Food percentage of flock X = \dfrac{57}{300}\times 100=19\%

Food percentage of flock Y = \dfrac{153}{300}\times 100=51\%

Food percentage of flock Z = \dfrac{90}{300}\times 100=30\%

Hence, the percentage would be 19%, 51% and 30%.

9 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which structure is correctly paired with its function?
    13·2 answers
  • Multicellular organisms have five levels of organization ranging from simplest to most complex. The simplest level is the cellul
    14·2 answers
  • The ___ chromosome is the sex determiner for many species<br><br> a. Female <br> b. Male
    8·2 answers
  • What caused the ph of solution to increase
    9·1 answer
  • Hypothesize why only one genus and species remains in the hominin group
    14·1 answer
  • What is a european starlings ecological role
    5·1 answer
  • What feature of this plant stops large animals from eating it?
    12·1 answer
  • Give an example of what would be membrane enclosed organelles in a eukaryotic cell.​
    6·2 answers
  • Help please don't know the answer​
    7·2 answers
  • How are the tomato epidermal cells similar to the onion and lettuce cells
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!