1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
13

Which statement best describes why an organism is less active when temperatures is too high?

Biology
1 answer:
torisob [31]3 years ago
6 0

Answer:

c) The organism would be less active because everything loses energy when it’s too cold.

Explanation:

You might be interested in
To make sensations possible what must be converted to send signals to your brain
Bess [88]
I think the answer is glucose converted to ATP..
5 0
3 years ago
In North American society, categories such as age, ethnicity, gender, sexual orientation, disabilities, and religion are all con
sineoko [7]

Answer:

social constructs

Explanation:

however it is not true that gender is actually a social construct

6 0
3 years ago
As human travel increases, the number of introduced species likely
andreyandreev [35.5K]

As human travel increases , the number of introduced species likely increases .

<h3>What is species and how human travelling can increase the number of introduced species?</h3>
  1. As humans will start moving more from one place to another there will be more species number.
  2. The number of introduced species will increase sharply seeing the increase in the number of human population doing migration and travelling.
  3. The breakdown of regional distinctiveness leads to increase in the travelling period of the humans .
  4. And most importantly the introduction of new species will increase and will be impacted by the human who have come from elsewhere for either travelling purposes or migration purposes.

To know more about species visit:

brainly.com/question/13259455

#SPJ13

4 0
1 year ago
Does the stroma nd the thylakoid membranes have the same function in the chloroplast
IrinaK [193]
No they do not have the same process but they are very close and work in function with each other

The Stroma is the colorless fluid surrounding the grana (or Granum) and enzymes in the process of photosynthesis is embeded in the stroma and also the thylakoid membranes

Thylakoids are the site of the light-dependent reactions of photosynthesis. Thylakoids<span> consist of a </span>thylakoid <span>membrane surrounding a </span>thylakoid<span> lumen. They normally stack up in stacks called Granum and the Stroma surrounds</span>
5 0
4 years ago
Pls help with the highlighted just send me a pic on safari or something.
ratelena [41]

Answer:

your answer is attached

5 0
3 years ago
Read 2 more answers
Other questions:
  • A renewable source of energy
    13·2 answers
  • The energy role of the first organism in a food chain is always a(n)______.
    7·2 answers
  • Over the last several decades, the scientific community has gathered a large amount of information regarding genetics and geneti
    14·2 answers
  • What do bones contain?
    13·1 answer
  • The rock cycle is defined as what?
    10·1 answer
  • Identify five different types of fossils
    6·2 answers
  • Which of the following stresses would most likely cause an ecosystem to respond by succession?
    15·2 answers
  • Which of these processes as a cooling affect on earth? (APEX)
    8·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • What do ribosomes produce following
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!