1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
13

Overfishing of salmon has caused populations of wild salmon to decline. To combat this decline, salmon are raised in hatcheries,

and then released to the wild. However, researchers have found that hatchery-raised salmon have reduced reproductive success in the wild, compared to wild salmon. They have also identified many genetic differences between hatchery-raised and wild salmon. Which statement describes the most likely reason for the differences between hatchery-raised and wild salmon? A. The pressures of a hatchery environment and of the wild environment select for different traits. B. Hatchery-raised salmon develop into stronger swimmers than those raised in the wild. C. The pressures of a hatchery environment promote convergent evolution between hatchery-raised and wild salmon. D. Hatchery-raised salmon have evolved to have completely different genomes from those of wild salmon.
Biology
2 answers:
Maslowich3 years ago
8 0

Option A, The pressures of a hatchery environment and of the wild environment select for different traits.


The various pressures in wild environment include the competition for food and survival, threat of prey etc. The effect of domestication on salmon can also be a reason for its low productivity in wild environment. Some other factors that might have affected the regular productivity of salmon in wild environment include- captive rearing, inbreeding among close relatives and ability of some fish to adapt to the unique hatchery environment.



garik1379 [7]3 years ago
7 0

the answer option is A

You might be interested in
Which of the following terms describes all of the non-living components of an ecosystem
Svet_ta [14]

Abiotic: which are the non-living factors and chemicals in environments which can affect the ecosystem.

6 0
3 years ago
Read 2 more answers
I NEED HELP ASAP!!! 99PTS!
zhannawk [14.2K]

Hey!

The correct answers for the blanks that I can answer (as a third-person answerer) are as follows:

*No, some collisions do not cause reactions due to a lack of energy or ability to properly collide.

*Speed

*A change in temperature of the bicarbonate reaction may lead to a quicker reaction with CO2-producing molecules.

I hope I helped!

Feel free to leave a comment down below if you need any more assistance or if I skipped any sections of the prompt. I will gladly help you with anything! :)

3 0
3 years ago
A species was added into a particular ecosystem to control the population of a prey species. This method of introducing a new sp
denpristay [2]
Biological augmentation, bioremediation , or reforestation are names for the method.
4 0
3 years ago
Read 2 more answers
In what phase of mitosis do the centrioles separate?
Olegator [25]

Answer:

Prophase

Explanation:

During prophase, chromatin condenses into chromosomes, and the nuclear envelope, or membrane, breaks down. In animal cells, the centrioles near the nucleus begin to separate and move to opposite poles (sides) of the cell.

4 0
3 years ago
Read 2 more answers
Refer the the graph below showing the absorption spectrum of chlorophyll a. Explain what the graph is showing
Stella [2.4K]

Answer: The graph shows that chlorophyll a absorbs light principally around 420-450 nm and 650-680nm wavelengths

Explanation: Chlorophyll a is a pigment found in plants that traps light energy for use in photosynthesis. Chlorophyll a absorbs light mostly in the blue and orange-red wavelengths. This is shown in the graph, where the peaks are around the 400nm and 600nm wavelengths, corresponding to blue and red in visible light.

This absorption means the pigment is 'excited' by this light, sending into a higher state if energy which provides energy for the reactions of photosynthesis.

7 0
3 years ago
Other questions:
  • A --------------- serves as a long-term storage area for water or nutrients.
    12·1 answer
  • How does a cell at the end of the first phase of the cell cycle differ from a cell at the end of the second phase
    13·1 answer
  • True or false? as they mature tracheids die leaving only their cell walls
    7·2 answers
  • Identify the process in the water cycle that changed water vapor into liquid water droplets that formed the thunderstorm cloud?
    12·2 answers
  • Write a paragraph as if you are a molecule of ammonia that will be converted to uric acid and then to urea and excreted as urine
    12·2 answers
  • Producers, like this plant, take in oxygen and release carbon dioxide during __________________ , just like animals and other li
    10·2 answers
  • A sample of cells was sent to a lab. The lab technician measured a chemical that the cell produced that caused the other
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Carried out in animals
    13·1 answer
  • There are two types of reactions in photosynthesis: light-dependent reactions and light-independent reactions. A group of biolog
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!