B because it’s talking about the tree itself. Saying that it’s plants would divert it to a different plant. The cells of the wood is what makes the tree and is relevant to the question
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
They are all rock with different size and shapes and are located in different areas possibly in the same areas but they all have there own unique textures from the photographs and 3 of them look like maybe a fossil of some type of when the dinosaurs where still around and the rocks on the top left corner look smooth and are a small type of igneous rocks. That have been soothed over the years.
Part A:
A - cell/plasma membrane.
B - Nucleus
C - mitochondrion
Part B:
A - (cell membrane) regulates what enters and leaves the cell.
B - (nucleus) controls cell activities or contains the genetic codes.
C - (mitochondrion) respiration or energy release or production of ATP.
Part C:
Photosynthesis
Production of cellulose
Produces chlorophyll
Producing its own food
Hope this helps you! (:
-PsychoChicken4040
