All categories

3 years ago

Why is a primary far less common and takes much longer to complete than secondary succession ?

1 answer:

8 0

Secondary succession generally takes place faster in comparison to primary succession as the substrate is already present. In the case of primary succession, there is no soil and it consumes much time to form.

Primary succession takes place in mainly lifeless regions, that is, the regions in which the soil does not possess the tendency of sustaining life as an outcome of various factors.

On the other hand, secondary succession takes place in the regions where a community that previously prevailed have been eradicated and is epitomized by smaller scale turbulence, which do not eradicate all the forms of life and nutrients from the environment.

You might be interested in

What is the benefit of the floating logs in Spirit Lake?

galina1969 [7]

Answer: Bio film that grows on the logs and feeds the lake.

5 0

3 years ago

What is the function of the human immune system

pshichka [43]

The immune system<span> is made up of a network of cells, tissues, and organs that work together to protect the body. One of the important cells involved are white blood cells, also called leukocytes, which come in two basic types that combine to seek out and destroy disease-causing organisms or substances.</span>

6 0

3 years ago

Read 2 more answers

Classification of carpet grass from kingdom to class level

Bumek [7]

Answer:i dont eve k

Explanation:

becouse i dont

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

How does gravitational electrical and magnetic forces act on a maglev train

vampirchik [111]

The gravitational force is being felt as the Earth pulls the train downwards using the two forces. The coils that provide the forces releases an electrical current which makes an electromagnetic field. It repels the materials with an equal force that goes up as well.

5 0

3 years ago