1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
11

A solution that contains equal number of hydrogen and hydroxyl ions would be called

Biology
1 answer:
Norma-Jean [14]3 years ago
5 0

Answer: Neutral solution

 

Neutral solution have equal number of hydrogen ions and hydroxyl ions in a solution. Its pH is naturally equal to 7 and the charge in that solution is neutral since the concentrations are equal. In the event that the concentration is unequal, the solution would have had a positive or negative charge.

Additionally, acidic solutions have more hydrogen ions than hydroxide ions while an alkaline solution contains more hydroxide ions than hydrogen ions.

 

 

 

You might be interested in
Help with junior biology assignment.
uysha [10]

Answer:

1.

a)dd

b) dd

c) 0%

2.

a) 25%

b) 75%

c) 25%

3.

a) 03

b) 0

c) tt

4.

a) FF x ff OR FF x Ff OR FF x FF

b) Because all the children have freckles

5.

a) 4:0

b) 100%

6.

a) 50%

b) Bb

c) 3 out of 6 (including parents)

8 0
3 years ago
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous r
Natasha2012 [34]

Answer:

Zone 4

Explanation:

The phreatic zone, or zone of saturation, is the part of an aquifer, below the water table, in which relatively all pores and fractures are saturated with water. Above the water table is the vadose zone.

The area between the top of the water table and beginning of bedrock/impermeable rock is the saturated zone.

3 0
3 years ago
Read 2 more answers
Why do scientists stain cells
Scilla [17]

Answer:

The most basic reason that cells are stained is to enhance visualization of the cell or certain cellular components under a microscope. Cells may also be stained to highlight metabolic processes or to differentiate between live and dead cells in a sample.

Explanation:

The main reason you stain a specimen before putting it under the microscope is to get a better look at it, but staining does much more than simply highlight the outlines of cells. Some stains can penetrate cell walls and highlight cell components, and this can help scientists visualize metabolic processes.

3 0
3 years ago
Read 2 more answers
What do we call the variable manipulated or tested by the investigator?
Agata [3.3K]

Answer:

1. The independent valiable is the answer

<em>Make</em><em> </em><em>me</em><em> </em><em>the</em><em> </em><em>brainliest</em><em> </em><em>please</em>

7 0
3 years ago
Other questions:
  • What limited protection do cells have against the damaging effects of uv radiation?
    13·1 answer
  • 3.
    7·1 answer
  • What is the largest natural population of organisms that can interbreed to produce fertile offspring?
    5·1 answer
  • Contraceptive pills mimic the ___________ feedback effect of ___________. positive; fsh and lh positive; estrogens and progester
    6·1 answer
  • How do scientists put a gene of one organism into another?
    11·1 answer
  • Which of the following is true? Seminal fluid is composed of semen and sperm. Sperm are composed of seminal fluid within a cell
    11·1 answer
  • 1. In any energy pyramid, only
    8·2 answers
  • What type of reaction is shown below?
    10·1 answer
  • Which of the following would likely move through the phospholipids of the
    15·2 answers
  • All sugars are considered:<br><br> a carb<br><br> a fat<br><br> just sugars<br><br> a lipid
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!