Everything that we eat and drink contains some percentage of water. So, to start, you have to know that the human body has receptors which estimate if we have enough water in our blood and cells in general. From these receptors, the information travels through the neurons to the part of the brain that is responsible for activation of different responses.
The digestive system is important because in its lower parts, liquids are absorbed and inserted in the bloodstream. Then through the bloodstream, they travel to all parts of the body and are absorbed by cells as needed. When blood passes through the body, it gets to the kidneys where water and electrolytes are filtered, reabsorbed if needed and excreted through the urine.
Now, if the brain has a signal that the body has a lack of liquids, it activates hormones which influence the bloodstream in both the digestive and the urinary system. In this case, the digestive system will absorb more liquids from food because the hormones will make the blood vessels in the digestive area larger, and on the other hand, we will produce less urine because the kidneys will get an assignment from the brain to filter liquids, but to reabsorb them again as much as possible.
The American public owns all federal public lands, including National Parks, National Forests, Wilderness areas, wild and scenic rivers, and wildlife preserves. Every American has a personal stake and a guaranteed say in how these places are cared for.
I also do Acellus :)
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Glycolysis is the breakdown of glucose where the final product is pyruvate, glycogenesis is the process of formation of glycogen and the product in first step is glucose-1-phosphate. Glycogenolysis is the process in which the initial reactant is glycogen, and gluconeogenesis is the formation of glucose from pyruvate.
<h3>What is glycogen?</h3>
Glycogen is a type of carbohydrate that is stored in the liver and gets converted into glucose in emergency situations.
It is formed by the process of glycogenesis and the first-step product is glucose-1-phosphate.
Glycolysis is the breakdown of glucose where the final product is pyruvate.
Glycogenolysis is the process in which have initial reactant glycogen and occurs when brain and muscle require immediate energy.
Gluconeogenesis is the formation of glucose from pyruvate.
Thus, these were the explanation for glycolysis, glycogenesis, glycogenolysis and gluconeogenesis.
For more details regarding glycolysis, visit:
brainly.com/question/14076989
#SPJ4
Answer:
a. disruption of mitotic spindle formation.
Explanation:
Vinblastine is a chemotherapeutic drug which is used to restrict cancer cell proliferation. During metaphase, it binds to microtubular proteins which play a very important role in mitotic spindle formation. If spindles will not form then during anaphase, the sister chromatids will not separate and mitosis will not take place. This is how hyper-proliferative cancerous cells are controlled from dividing and cancer is treated using this drug.
