1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
8

You are helping your brother build the deck. he accidentally cuts off his thumb. what should you do next?

Biology
1 answer:
netineya [11]3 years ago
8 0
The correct answer is "<span>Wrap the thumb in gauze, place in a bag and then on ice". 

Wrapping the cut-off finger in gauze or in any cloth, should be immediately placed in a bag then put on ice for it to be chilled. the thumb should not be exposed directly to the ice, or it will cause ice burns, wherein it will cause the thumb to not get sewn back. the ice is used to chill the thumb, to prevent the it from decomposing, not for freezing it. </span>
You might be interested in
Which gland secretes the most important hormone controlling calcium balance in the blood?
quester [9]

Answer: The Parathyroid gland

Explanation:

The Parathyroid gland secretes "Parathormone", an hormone that exerts

- direct influence on the bone by INCREASING the release of bone calcium ion (Ca2+) into the blood

- affects the kidney by stimulating the renal tubules to eliminate EXCESS calcium in the urine.

Thus, the calcium balance of the body depends on the secretion of the Parathyroid gland

7 0
3 years ago
How would flowering plants be affected if bees and butterflies became less common?
Blizzard [7]
Since bees and butterflies both pollen are flowers, the growth (population) of flowering plants would become less common without the pollen being spread.
6 0
3 years ago
Read 2 more answers
Cell biologist, Dr. Martine Dinen, is observing an organism's cell using a transmitting electron microscope. She notices that wi
notsponge [240]

Answer:

eukaryotic auto i think

7 0
3 years ago
Give a man a fish and hell eat for a day teach him to fish and get rid of him
Ludmilka [50]
This is very true but I don't see the question
3 0
3 years ago
Read 2 more answers
To which phase of disposal of stolen goods does altering serial numbers belong
frutty [35]
The alteration of serial numbers belong to the "Recovery of stolen electrical goods" phase.

NC, sterilization or removing a serial range is usually charged as a secondary offense aboard a thievery offense. Generally, a person who alters or removes a serial range is doing this to hide the actual fact that they either scarf the property or received transferred possession. As such, there's a public interest in toilsome people who have interaction during this activity.
3 0
3 years ago
Other questions:
  • A scientist measured an increase in nitrous oxide in the atmosphere. This increase would result in
    5·2 answers
  • How are the asthenosphere and the mantle related
    8·1 answer
  • A key should be parallel. An example of parallel choices is _____.
    9·2 answers
  • Adenosine triphosphate atp is important because it
    10·1 answer
  • I NEED HELP BAD..... Energy from the sun comes from nuclear fusion. What happens during that reaction?
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • PLEASE HELP ASAP!!
    10·2 answers
  • How many calories do proteins have?
    6·2 answers
  • 2 points<br>Identify the device shown<br>below and state its purpose<br>Your answer​
    9·1 answer
  • What do hormones and neurotransmitters have in common? how do they differ?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!