“E. coli can be considered a manufacturing unit in the field of genetic engineering.”

1 answer:

4 0

The answer is B. The recombinant DNA produced by the combination of a vector and the gene of interest are inserted in the E. coli, which produces multiple copies of this recombinant DNA along with the chromosomal DNA and expresses the gene of interest are inserted in the E. coli, which produces multiple copies of this recombinant DNA along with the chromosomal DNA and expresses the gene.

A recombinant DNA is artificially constructed DNA molecule with genes of interest that would not be present in the genome otherwise. Thanks to its quick reproduction cycle, E. coli serves as a manufacturing unit. The recombinant DNA is inserted in the E coli, which produces multiple copies of this recombinant DNA and expresses the gene of interest.

You might be interested in

Could a mixture be made up of only elements and no compounds?

AysviL [449]

The answer is False I believe
All matter can be classified into two categories: pure substances and mixtures. A pure substance consists of a single element or compound. A mixture, however, is made up of different compounds and/or elements.

5 0

4 years ago

the diagram shows the layers of Earth convection currents in which region influence the movement of tectonic plates

kramer

The answer is; Mantle

Convection currents in the mantle drive tectonic plate movements. The convection currents in this regions are like those of water. The cooler upper mantles sink to the bottom and the hotter lower mantle rises. This circulation causes fiction drag with the overlying crust and therefore causes it to drift.

5 0

4 years ago

Read 2 more answers

What is the mRNA that would be transcribed from this strand of DNA?

Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0

2 years ago

Which organ releases the hormone insulin in order to regulate the level of blood sugar in the body?

Sloan [31]