1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
4 years ago
7

“E. coli can be considered a manufacturing unit in the field of genetic engineering.”

Biology
1 answer:
Gnom [1K]4 years ago
4 0
The answer is B. The recombinant DNA produced by the combination of a vector and the gene of interest are inserted in the E. coli, which produces multiple copies of this recombinant DNA along with the chromosomal DNA and expresses the gene of interest are inserted in the E. coli, which produces multiple copies of this recombinant DNA along with the chromosomal DNA and expresses the gene.

<span>A recombinant DNA is artificially constructed DNA molecule with genes of interest that would not be present in the genome otherwise. Thanks to its quick reproduction cycle, E. coli serves as a manufacturing unit. The recombinant DNA is inserted in the E coli, which </span>produces multiple copies of this recombinant DNA and expresses the gene of interest.



You might be interested in
Could a mixture be made up of only elements and no compounds?
AysviL [449]
The answer is False I believe 
<span>All matter can be classified into two categories: pure substances and mixtures. A pure substance consists of a single element or compound. A mixture, however, is made up of different compounds and/or elements.</span><span />
5 0
4 years ago
the diagram shows the layers of Earth convection currents in which region influence the movement of tectonic plates
kramer

The answer is; Mantle


Convection currents in the mantle drive tectonic plate movements.  The convection currents in this regions are like those of water. The cooler upper mantles sink to the bottom and the hotter lower mantle rises. This circulation causes fiction drag with the overlying crust and therefore causes it to drift.    

5 0
4 years ago
Read 2 more answers
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which organ releases the hormone insulin in order to regulate the level of blood sugar in the body?
Sloan [31]

Answer:

Pancreas

Explanation:

Insulin is an essential hormone produced by the pancreas.

5 0
3 years ago
Read 2 more answers
Which of the following accurately describes algal blooms? A. Algal blooms tend to free up nutrients. B. Algal blooms provide add
Elanso [62]
The last one which is D
8 0
3 years ago
Other questions:
  • Motor impulses transmitted over the accessory (Cranial Nerve XI), hypoglossal (Cranial Nerve XII), and vagus (Cranial Nerve X) n
    12·1 answer
  • The____is the one factor that can be manipulated by the experimenter
    11·1 answer
  • What is the difference between chemosynthesis and photosynthesis?
    13·2 answers
  • Compare renewable and nonrenewable energy sources and discuss the effects of each on biodiversity?
    13·1 answer
  • Why do we use nanometers in microscopy ??
    8·1 answer
  • In which part of the chloroplast is there a high concentration of protons?
    11·1 answer
  • How are continental and oceanic plates different
    15·2 answers
  • Which career combines DNA technology and medicine?
    8·2 answers
  • Please help me with this I’ll mark you brainly <br><br> The Picture is above
    5·2 answers
  • Leech sucking human blood
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!