1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
7

In three activities, how can I change my daily habits to help the ecosystem?

Geography
2 answers:
Valentin [98]3 years ago
5 0
Instead of using a car, use a bike to help not pollute the air. Recycle water bottles. And use energy-efficient light-bulbs.
Luba_88 [7]3 years ago
5 0
<h3><u>1. Save water as much as possible :</u></h3>

Hot water from the tap often requires running cold water until we can get hot water. In most cases instead of preserving the cold water in the container to use later, we let it run down the drain and get wasted. This happens in kitchen sinks, bathroom sinks and showers. On a daily basis, a lot of liters of water is wasted this way.

<h3><u>2.  Opt for reusable plastic bags :</u></h3>

Bags end up in landfills or causing litter in the environment. The danger of plastic bags is that most of them don't decompose. Animals and birds digest this material and die. Another environmental hazard from plastic bags is increased pollution in rivers, streams and oceans. Therefore, a reusable plastic bag reduces the frequency of buying and disposing, protecting the environment.

<h3><u>3.  Do not litter :</u></h3>

Packages whether it is food packaging or packages for other products have a “don't litter” or “throw in a rubbish bin” message and recycling sign. Regardless of that, there is rubbish all over. Avoid littering and using save and recommended manner of disposing of garbage is very important.

You might be interested in
What is the Basic Income Level
ipn [44]
I think Basic income systems that are financed by the profits of publicly owned<span> enterprises (often called </span>social dividend<span>, also known as </span>citizen's dividend<span>) are major components in many proposed models of </span>market socialism.<span> Basic income schemes have also been promoted within the context of </span>capitalist<span> systems, where they would be financed through various forms of taxation. Hope I helped!!</span>
7 0
3 years ago
Which person was most important for the formation of the Soviet Union?
Tresset [83]
Joseph Stalin was the most important person of the formation of the Soviet Union
6 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
10 facts about the tukano tribe
docker41 [41]
<span>1they live in In the north of the amazon rainforest : south America.
2they eat a</span><span>nything that they can collect in the forest ... EG. animals, berry's, nuts , seeds , flowers , plants and anything that they can really find / forage for
</span><span>3The Tucano are a multilingual people because men must marry outside their language group; that is
 4no man may have a wife who speaks his language, for that kind of marriage relationship is not permitted and would be viewed as a kind of incest.
</span><span> 5 the Tucano practice linguistic exogamy
</span>6<span> They are usually described as being made up of many separate tribes</span><span>, although the appellation is somewhat problematic due to the complex social and linguistic structure of the region
7</span> <span>The Tukano recognize 137 varieties of manioc
8 the tukano </span>tribe<span>, which extends into Brazil and is the largest group
9</span>They<span>'re never the </span>work<span> of committees of living individuals
10</span>The Tukano<span> are 6,000 people living in the border with Colombia and Venezuela</span>
4 0
3 years ago
Which Rock has the highest metamorphic grade
Veseljchak [2.6K]
Schist has the highest metamorphic grade.
4 0
3 years ago
Other questions:
  • How many countries are in Africa?
    15·2 answers
  • 18°C = _____<br><br> -255 K<br> 0 K<br> 18 K<br> 291 K
    6·2 answers
  • The type of erosion that causes the most dramatic and visible changes in the landscape.
    15·2 answers
  • What imaginary line is located at 0 degrees longitude?
    13·1 answer
  • As young parents, it may be easy to get frustrated and find yourselves at a loss with your children. Search online for ways to a
    14·1 answer
  • Which area would expeeiance the most erosion? An area with frequent rainstorms or an area with little moisture
    10·1 answer
  • Converting is a key skill when working with maps and scales. Tracking units and showing any conversion factors is an important p
    13·1 answer
  • Difference between developed and developing countries?
    8·2 answers
  • Why have locks been created between the Great Lakes and the St. Lawrence River?
    12·1 answer
  • In one to two sentences, identify and describe the processes that must happen for sand to eventually become metamorphic rock.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!