I think Basic income systems that are financed by the profits of publicly owned<span> enterprises (often called </span>social dividend<span>, also known as </span>citizen's dividend<span>) are major components in many proposed models of </span>market socialism.<span> Basic income schemes have also been promoted within the context of </span>capitalist<span> systems, where they would be financed through various forms of taxation. Hope I helped!!</span>
Joseph Stalin was the most important person of the formation of the Soviet Union
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
<span>1they live in In the north of the amazon rainforest : south America.
2they eat a</span><span>nything that they can collect in the forest ... EG. animals, berry's, nuts , seeds , flowers , plants and anything that they can really find / forage for
</span><span>3The Tucano are a multilingual people because men must marry outside their language group; that is
4no man may have a wife who speaks his language, for that kind of marriage relationship is not permitted and would be viewed as a kind of incest.
</span><span> 5 the Tucano practice linguistic exogamy
</span>6<span> They are usually described as being made up of many separate tribes</span><span>, although the appellation is somewhat problematic due to the complex social and linguistic structure of the region
7</span> <span>The Tukano recognize 137 varieties of manioc
8 the tukano </span>tribe<span>, which extends into Brazil and is the largest group
9</span>They<span>'re never the </span>work<span> of committees of living individuals
10</span>The Tukano<span> are 6,000 people living in the border with Colombia and Venezuela</span>
Schist has the highest metamorphic grade.