1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
5

Small,rocky bodies that revolve around the sun are called

Biology
2 answers:
nasty-shy [4]3 years ago
5 0
Small rocky bodies- Planets
Tatiana [17]3 years ago
3 0
Small rocky bodies that revolve around the sun are asteroid's
You might be interested in
A client's laboratory findings showed increase in serum alkaline phosphatase and urinary hydroxyproline levels. which condition
uysha [10]
<span>The nurse will most likely observe Paget's disease on the client's medical chart. Paget's disease interferes with the body's bone tissue recycling process and results in increased blood flow around affected bones, flushing extra alkaline phosphatase and urinary hydroxyproline from the body.</span>
7 0
3 years ago
Read 2 more answers
mollusks and arthropods get hit by water constantly so they built protective shell what can we hypothesize from this?
harina [27]

Answer:

Convergent Evolution.

Explanation:

When two different species that are very distantly related but have similar traits its Convergent Evolution due to environmental pressures.

3 0
3 years ago
During the rainy months in Africa, temporary pools of water form. One fish species, the snakehead fish, is able to walk, using p
Vaselesa [24]
<span>B) The snakehead fish will replace the other fish species.</span>
6 0
3 years ago
Read 2 more answers
Describe 3 main differences between rna and dna
Sati [7]

Answer:

The three main differences between RNA and DNA is that (1) The sugar in RNA is ribose instead of deoxyribose, (2) RNA is generally single-stranded and not double-stranded , and (3) RNA contain uracil in place of thymine. ... The three min types of RNA are Messenger RNA, Ribosomal RNA, and Transfer RNA.

Explanation:

hope it helps : )

5 0
3 years ago
Write any two adaptational characteristics of camel on the basis of habitat.​
Vera_Pavlovna [14]
Long eyelashes that doesnt allow the sand to get into its eyes
And its ability to store water for long periods of time in its hump
5 0
2 years ago
Other questions:
  • Why was natural selection an important contribution to the theory of evolution? It proved that evolution is true. It explained h
    6·2 answers
  • How is the DNA in a prokaryote different from the DNA in a eukaryote?
    13·2 answers
  • The small, multicellular structures by which<br> liverworts reproduce asexually are
    10·1 answer
  • What materials, represented by x are used by a mitochondrion during respiration?
    11·1 answer
  • Which of the following is homozygous dominant? a AA b Aa c aa
    6·1 answer
  • Use words and diagrams to summarize the steps of replication, in order, in the boxes below
    15·1 answer
  • how does tobacco smoke effect the body? a.it blocks hemoglobin from binding to oxygen, thus affecting gas exchange in the lungs
    8·1 answer
  • Why is secondary lung cancer common?
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • In what direction, clockwise or counterclockwise, do the major circulation patterns rotate in the northern and southern hemisphe
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!