1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
3 years ago
10

Which one of the following statements is accurate​

Biology
1 answer:
icang [17]3 years ago
8 0

b i gotta write 20 words thats bs but i think its b

You might be interested in
Binding of ________________ to receptors (ligand-gated) on the sarcolemma at the neuromuscular junction is vital for depolarizat
kifflom [539]

Answer:

Binding of   <u>ACh (acetylcholine)  </u>  to receptors (ligand-gated) on the sarcolemma at the neuromuscular junction is vital for depolarization of the muscle fiber.

Explanation:

It allows acetylcholine to be released into this synapse when an action potential hits a neuromuscular junction. Acetylcholine attaches to the nicotinic receptors localized on the post-synaptic membrane of the muscle fibre's motor end plate, a specialized region.

Hence , the answer is  <u>ACh (acetylcholine) .</u>

8 0
3 years ago
The size of food web is limited by the number of
Debora [2.8K]

The size of food web is limited by the number of animals included in the area.

-Pepetreefrogthe2nd

3 0
3 years ago
Read 2 more answers
What may be saturated or unsturated?
koban [17]

Answer:

Below:

Explanation:

Saturated fatty acids lack double bonds between the individual carbon atoms, while in unsaturated fatty acids there is at least one double bond in the fatty acid chain. Saturated fats tend to be solid at room temperature and from animal sources, while unsaturated fats are usually liquid and from plant sources.


Hope it helps..

It’s LoyalGirl....

7 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Discuss two ways gravity contributes to erosion
Advocard [28]

Answer:

The force of gravity can cause erosion by;

  1. pulling rocks and other particles down the side of a mountain or cliff
  2. it can cause landslides which significantly erode an area.
3 0
3 years ago
Other questions:
  • You are a pelican searching for fish in the ocean from high in the sky. although you see no tasty fish in the open ocean, you so
    11·1 answer
  • What where the conditions like on early earth
    11·1 answer
  • Put the following stages in order
    11·1 answer
  • What are extensions of the plasma membrane that serve primarily to increase a cell's surface area called?
    13·1 answer
  • URGENT!!! Why do identical twins have the same set of genes?
    10·2 answers
  • Two of the six Kingdoms are Prokaryotic, which means that their cells have no nucleus. These two kingdoms are Eubacteria and Arc
    8·2 answers
  • How do i answer this? i don't understand it.
    7·1 answer
  • How can u apply in th real world next genration sequencing
    12·1 answer
  • I’ll mark brainiest if your right need ASAP
    8·2 answers
  • Which weather pattern consists of a high-pressure system with descending cool, dry air that leads to clear weather?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!