1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alik [6]
3 years ago
13

Njfuchehe lolnsudbdndnxj jfhf

Biology
2 answers:
Bond [772]3 years ago
5 0

Answer:

2jwjwjwjsksijwiwajssksi

kumpel [21]3 years ago
3 0

Answer:

xvdccbvcbnvndnfgxcgfbfngf

Explanation:

You might be interested in
Which part of cell division is different and plant and animal cells
OlgaM077 [116]

Answer:

cytokinesis

Explanation:

The most important and observable difference in the plant animal cells mitosis is the cytokinesis.

5 0
3 years ago
Archaebacteria and eubacteria are classified into different kingdoms, but at one time they were both classified in the Kingdom M
vodomira [7]

Answer:

I think the option C is correct

6 0
3 years ago
Read 2 more answers
17. Advantages of using tidal power include:
Oksi-84 [34.3K]

c my brotha y'w prob alr took da quiz

7 0
3 years ago
Pleassseeee heeellppp
lesya692 [45]

it's kinda blurry...I can hardly see but I'll try n answer

6 0
3 years ago
Please answer all i need help quick
svet-max [94.6K]

Answer:

1. B

2. B

3. A

4. B

Explanation:

1. Species is smaller than kingdom, and domain isn't a group

2. Its kinda obvious

3. Not too sure on this one, but i think a is right

4. Pro means 'before nucleus', therefore it has no nucleus

3 0
4 years ago
Other questions:
  • A cycad has
    12·1 answer
  • Match the name of the following compound: MgSO4 · H2O
    8·1 answer
  • _ are larger cells with membrane-boundemembrane-boundemembrane-boundemembrane-bounded organelles.
    14·1 answer
  • During the process of translation in a eukaryote messenger RNA is spliced in the nucleus. amino acids are synthesized by RNA pol
    13·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • 1.Watson and Crick knew that the triple helix model of DNA that Linus Pauling had proposed was incorrect. What evidence did they
    6·1 answer
  • A substance that is produced by a plant that affects how it grows and develops is called a
    8·2 answers
  • Use the drop-down menus to select the names of the labeled structures.
    8·2 answers
  • Leukopenia is a condition characterized by a decrease in white blood cells. What effect does leukopenia have on the body's abili
    6·2 answers
  • all other factors (concentration, solute size, etc.) being equal, which type of solute does a cell tend to pull inside?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!