1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
topjm [15]
3 years ago
9

CCC Predict: Suppose you randomly picked out two members of the

Biology
1 answer:
Firlakuza [10]3 years ago
7 0

Answer:

genus

Explanation:

the closer something is to species, the more they have in common. and genus is closer to species than phylum

You might be interested in
Essay : What is the impact of pandemic on climate change and vice versa?​
Mademuasel [1]

Answer:

.

Explanation:

To explain the last sentence, what I mean by that is the sudden decrease in air pollution in just a few weeks is what would have typically taken multiple years to do. Due to less drivers, factories shutting down, and more, less toxic and infirm mental hazardous chemicals were released into the atmosphere in an extremely short amount of time. However, nowdays, it is almost back to where is was before the pandemic.

6 0
2 years ago
The Venus fly trap has 8 chromosomes in each diploid cell. How many chromosomes will be in the fly traps gametes?
nirvana33 [79]

Answer:

Because gametes are haploid cells they have half the number of chromosomes in a normal diploid cell. Therefore, the fly traps gamete cells will have 4 chromosomes.

Explanation:

7 0
3 years ago
Why Do You Think Soil Erosion Increased Over Time ?
Firdavs [7]
Because Running water is the leading cause of soil erosion, because water is abundant and has a lot of power. Wind is also a leading cause of soil erosion because wind can pick up soil and blow it far away. Activities that remove vegetation, disturb the ground, or allow the ground to dry are activities that increase erosion.
3 0
2 years ago
Which information can be determined from the chemical formula C6H12O6?; What is the correct formula for photosynthesis?; How are
3241004551 [841]

The chemical formula C6H12O6 is the chemical formula of glucose which is a monosaccharide containing an aldehyde group (-CHO) with 6 carbon atoms, 12 hydrogen atoms and 6 oxygen atoms. Glucose is a product produced from photosynthesis.

The chemical molecular formula for the photosynthesis process is 6CO2+6H2O→C6H12O6+6O2. The synthesis process is a reaction that occurs in plants to produce food to be used as energy for cells. The process of photosynthesis requires materials in the form of air which is represented by H2O and carbon dioxide which is represented by the formula CO2 in the chemical formula of the photosynthesis process. The products of photosynthesis are glucose which is represented by C6H12O6 and oxygen which is represented by O2 in the chemical formula.

Some people often refer to the chemical formula of photosynthesis as CO2+H2O→C6H12O6+O2, this formula is an unbalanced equation. Because the auction will produce glucose with the chemical formula C6H12O6 having 6 carbon atoms, 12 hydrogen atoms and 6 oxygen atoms, then should the chemical formula carbon dioxide H2O and water O2 also have a total of 6 carbon atoms, 12 hydrogen atoms, and 6 oxygen atoms.

Learn more about  photosynthesis at:

brainly.com/question/1388366

#SPJ4

3 0
1 year ago
In pea plants white seed coat is a recessive trait and gray seed coat is a dominant trait which Offspring Have a white seed coat
FromTheMoon [43]
the answer would be we
8 0
3 years ago
Read 2 more answers
Other questions:
  • If you were a doctor, and a lab technician told you that the results of a patient’s lab results were Gram positive, what antibio
    15·1 answer
  • Decay
    14·2 answers
  • What is the significance of the Galapagos Islands to the Theory of Evolution?
    15·1 answer
  • PLEASE HELP! 25 Points!
    15·1 answer
  • Please help !!! Explain how a change in an abiotic factor, such as sunlight, would affect biodiversity.
    13·2 answers
  • Thank you for helping if you do
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is an important function of the urinary system?
    8·1 answer
  • the is the thin layer of the mucosa responsible for pulling the mucosa into its many folds which increases the surface area of t
    7·1 answer
  • What is the sequence of events that occur in order for the posterior lobe of the pituitary gland to release hormones into the bl
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!