1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
3 years ago
7

Hey!! Could someone help me? I need a definition and examples of geology!!

Biology
1 answer:
Alex73 [517]3 years ago
8 0

Geology is a branch of natural science that studies rocks, how they form, etc.

This field of study enabled us to know the age of Earth, the different layers that make up earth amongst many other things.


Hope it helped,


BioTeacher101


(If you have any questions, feel free to ask them in the comments)

You might be interested in
Galapagos tortoises have specific modifications that allow them to consume food and survive on the Galapagos Islands. Arrange th
stich3 [128]

4. (Tortoises swam...) 5. 1. 3. 2. 4 (Over time...) would be the best sequence I guess.


The parenthesis behind the fours is just for you to know which four I'm talking about (you have 2 fours).




Hope it helped,


Happy homework/ study/ exam!

3 0
4 years ago
Read 2 more answers
2. Which statement correctly describes pathogens?
Airida [17]
Option D. They cause disease.
3 0
3 years ago
How dose light intensity affect the rate of photosynthesis
VMariaS [17]
As light intensity increases, the rate of photosynthesis increases. As the intensity decreases, so does the rate of photosynthesis 
6 0
3 years ago
Read 2 more answers
Which of the following is a cause of water movement?
Pavlova-9 [17]

Answer:

All of the above.

All the above is the cause of water movement.

3 0
3 years ago
Read 2 more answers
(Only answer it if you know the answers)
stepan [7]

Answer:

B) limestone

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following mineral characteristics refers to the quality of light reflected from a mineral's surface?
    9·2 answers
  • Why is the earth's gravity stronger than the moon's gravity? A:The moon is so far away from earth. B:The earth is more massive t
    9·2 answers
  • What is the strongest earthquake wave
    10·1 answer
  • Which diagnostic test involves a series of blood tests that include total cholesterol, high-density lipoprotein, low-density lip
    15·1 answer
  • Tay-Sachs disease is prominent among African-Americans Italian-Americans Native Americans Jewish-Americans
    8·1 answer
  • All organisms need energy from food in order to survive. Plants produce their own food through photosynthesis. Animals must find
    5·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which best explains why a thick tropical forest filled with large plants typically has a lot of water vapor in the air
    13·2 answers
  • Reproductive cells are created by _____.
    6·1 answer
  • Which of the following represents the impacts of drilling and fracking on human health
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!