When a human dies, his corpses gets decomposed by decomposing bacteria. What's produced by the decomposing bacteria is the "fertilizer" for plants.
Answer:
The incorporation of radiolabeled amino acids during protein synthesis occurs when the data shows the organelles involved with protein synthesis, packaging and transport, that is, radioactivity levels would increase first at the rough endoplasmic reticulum, followed by the Golgi, and then the secretory vesicles (option C).
Explanation:
Protein synthesis in the cell occurs when RNA -which contains the sequence of triplets or codons that make up the genetic code- is coupled to ribosomes.
Each codon or triplet, consisting of three nucleotides, will give instructions for specific amino acids to be incorporated into the polypeptide chain that is being synthesized in the rough endoplasmic reticulum.
The Golgi apparatus is responsible for packaging or packaging the newly synthesized proteins in secretory vesicles for transport.
<em>In consecuense, </em><u><em>radioactivity levels would increase in the organelles involved in protein synthesis, packaging and transport, the rough endoplasmic reticulum, Golgi apparatus and secretory vesicles</em></u><em>, respectively.</em>
<em />
Learn more:
Steps of protein synthesis brainly.com/question/884041
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
The emergence of new species from surviving ancestral species and both species continue to interact during a transition period is known as Sympatric Speciation.
Explanation:
Hybrid Zone is the area where two species continue to interact. Hybrid offspring are produced by two different species.
1) hybrid offspring
2) zones
3) reinforces
4) zones
5) Slow down
6) gradual speciation model
7) punctuated equilibrium
Q1 is A
Q2 Is A
Q3 is A
Cool! All A's
