1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inessss [21]
2 years ago
8

Cells rely on compounds that readily store and release energy. Which statement describes how

Biology
1 answer:
barxatty [35]2 years ago
5 0

Answer:

DA brain

Explanation:

You might be interested in
Why are algae and ferns both green?
olganol [36]
They each contain chlorophyll that absorbs violet-blue light and reflects green light.
8 0
3 years ago
Read 2 more answers
What are some diseases that can be passed down as genetic traits? list 5 or more/
Oxana [17]
The diseases which can be passes down as genetic traits are known as "Inheritable disease" some examples are:

1) Haemophilia
2) Phenylketonuria
3) Down's Syndrome
4) Turner's Syndrome
5) Klinefelter's Syndrome

Hope this helps!
6 0
3 years ago
Read 2 more answers
Cleaning products and household cleaners are mostly? A.Basic . Acidic C. Neutral D. none of the above
valkas [14]
B. Acidic
Hope this helps!!
8 0
3 years ago
Read 2 more answers
The two main types of fermentation are called
jok3333 [9.3K]
The two main types of fermentation are alcoholic fermentation and lactic acid fermentation. In an alcoholic fermentation, the main product of this process is ethyl alcohol. Lactic acid on the other hand has lactic acid as its main product. When muscle cells run out of oxygen, lactic acid fermentation would commonly take place.<span> </span>
7 0
3 years ago
What are TWO transgenic crops on the market today? What are the enhancements these crops have? Where did the genes for these tra
hichkok12 [17]
I believe that corn is one of them.
8 0
2 years ago
Other questions:
  • What are three nucleotides together called on mRNA?
    8·1 answer
  • 2. Hepatitis D is a defective form of the virus that needs Hepatitis B to exist.
    11·1 answer
  • Which area of the brain is most closely associated with alertness?
    9·1 answer
  • A normal father marries woman who is a carrier for duchenne's muscular dystrophy, a recessive sex linked disorder. Any male chil
    15·1 answer
  • Because of hydrogen bonding, water is uniquely suited for its central role in life. Many hydrophilic molecules interact freely w
    10·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • PLEASE ANSWER. THIS IS A QUESTION FOR MY PROJECT DUE TOMORROW.
    8·1 answer
  • Which is the relationship between photosynthesis and cellular respiration?
    15·1 answer
  • Of the three major types of handwriting characteristics line form includes, smoothness of the lines,
    5·1 answer
  • Any body come with me for test​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!