1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleonysh [2.5K]
3 years ago
12

Which of these provides the best evidence of the environment in which an igneous rock was formed?

Biology
1 answer:
Helga [31]3 years ago
7 0
<span>The texture of the rock is a great example of the environment for igneous rocks. Many rocks of this type tend to have very jagged or rough textures, and are shown to come from environments that are high in heat, pressure, and also change greatly over short periods of time due to the many eruptions and lava flows that take place.</span>
You might be interested in
If aerobic exercise improves heart strength so that it pumps more blood with each beat, what likely happens to the heart rate as
shutvik [7]

As the cardiac muscle gets stronger, the amount of blood pumped with each beat increases which in turn makes the heart more efficient overall. As a result, we can infer that as the cardiac muscle gets stronger, the heart rate will decrease since it is able to pump more blood with each beat

7 0
3 years ago
When guanine pairs with cytosine how many hydrogen bonds are formed
sattari [20]

3 hydrogen bonds are formed.

3 0
3 years ago
Read 2 more answers
What is kinesiology, and what are the seven types of science it encompasses?
Kruka [31]
<span>Kinesiology is the study of human or non-human body movement. The seven types of sciences it encompasses are physiology, anatomy, biomechanics, psychology, sociology, motor learning and sports pedagogy.</span>
6 0
3 years ago
What is the best way to document blood spatter patterns for subsequent bloodstain pattern analysis?
Advocard [28]
I Think That will be crime scene drawing
3 0
4 years ago
Pesticides may enter a forest ecosystem in a number of different ways. Sometimes,
mel-nik [20]

Answer:

A and B

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • 20 Points!!<br> Describe how an ionic compound is formed.
    5·1 answer
  • Bond formed by the sharing of electrons between atoms
    6·2 answers
  • Are animal vacuoles and animal vesicles the same?
    5·1 answer
  • The producers at the beginning of Earth's food chain are _____
    10·1 answer
  • Which of the following is not part of a chromosome?
    7·1 answer
  • As an impulse travels down an axon, ______________.
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • In sex linked inheritance, the heterozygous female is called
    10·1 answer
  • PLEASE HELP WHAT IS THIS BUG
    12·2 answers
  • Explain why dehydration synthesis make sense as the name of the reaction of creating polymers from monomers.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!