1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anuta_ua [19.1K]
3 years ago
14

An animal that eats the dead remains and wastes of other animals and plants.

Biology
2 answers:
stellarik [79]3 years ago
8 0
A scavenger does this :)
Lisa [10]3 years ago
7 0
A decomposer.

I hope this helps you, and have a good night! :D
You might be interested in
If this person had son,what,sex chromosome did they give their son?
dybincka [34]

Answer:

B

Explanation:

Y chromosomes are the male chromosome. A person with an XY sex chromosome pair will be male while that with an XX sex chromosome pair will be female. This is because the Y chromosome has a male-determining gene called the SRY. This gene is responsible for the development of testis.

3 0
3 years ago
Help cuh im to lazy and o don fill like doin this ill give u 25 points
aniked [119]
It’s easy bro just do it
8 0
3 years ago
Read 2 more answers
Fossil belong on the cladogram?
Natasha_Volkova [10]
No, cladograms deal with living species.
8 0
3 years ago
Read 2 more answers
The greenhouse effect _____________. select one:
iren [92.7K]
D. is a recent development resulting from the burning fossil fuels
3 0
3 years ago
Weathering and erosion both contribute to the disintegration of rocks. true or false
morpeh [17]
True because Weathering is the process breakdown of materials through physical or chemical actions and Erosion occurs when weathered materials such as soil and rock fragments are carried away by wind, water or ice. Many forces are involved in weathering and erosion, including both natural and man-made causes.This will causes rocks to disintergrate
4 0
3 years ago
Read 2 more answers
Other questions:
  • During which section of the geologic time scale did the first modern human evolve?
    6·2 answers
  • Which statement is true about fossils?
    13·2 answers
  • 3. Which of the following processes removes oxygen from the atmosphere?
    14·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Lactase is classified as which of the following macromolecules?
    5·1 answer
  • There is much controversy surrounding stem cells and the use of them. Do you think the use of stem cells is ethical? Why or why
    11·1 answer
  • Three factors that affect the abiotic environment of a tropical rainforest
    9·1 answer
  • The leaf shown has a color pattern of green and white.
    6·1 answer
  • It was my first day in the class. I was very nervous as the college was away from my home town. I had to stay away from my paren
    7·1 answer
  • How to calculate map distance between two linked genes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!