1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
5

What is the original source of energy for most living organisms?

Biology
2 answers:
Basile [38]3 years ago
8 0
The sun is the original source of energy to living organism
KonstantinChe [14]3 years ago
6 0
Sunlight is the original source of energy for most living organisms.
You might be interested in
Why is nitrogen important?​
Rama09 [41]

Answer:

Nitrogen is a constituent element and is part of many compounds in plants.

Explanation:

Nitrogen is a building block and there is no process in plants that is not affected by nitrogen.

If there is not enough nitrogen in the soil, the growth decreases, the leaves are yellow, pale green, chlorosis occurs, the root is removed, its branching is reduced, the yield and quality of fruits are reduced.

3 0
3 years ago
Read 2 more answers
Which of the domains include
grin007 [14]

Answer:

Domain Bacteria.

Explanation:

=)

7 0
3 years ago
How dose competition affect a population
mrs_skeptik [129]
Hopefully this helps .

6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
When you hold mug of coca,you fell a change in temperature. how dose the skin detect changes?<br>​
juin [17]

Answer:

sensory (afferent ) neurons

Explanation:

afferent or "sensory" neurons receive information from the external world and convey this information to the brain via the spinal cord .

4 0
3 years ago
Other questions:
  • A provider admits mrs. smith to the hospital. she is there for five days. the provider sees her each day she's in the hospital.
    11·1 answer
  • Which sphere is most directly studied <br><br> by an astronomer
    14·1 answer
  • The word “cumulative” means that something builds on itself. Which example best shows how scientific knowledge is cumulative?
    8·1 answer
  • How are photosynthesis and cellular respiration similar
    12·1 answer
  • A wilted flower placed in a vase of water for several hours became stiff and stood erect. when it was placed in a salt solution,
    13·1 answer
  • Find the density of an object that has a mass of 22.3g and a volume of 136.7cm3.
    11·1 answer
  • Methane is a molecule that has four hydrogens covalently bonded to one carbon atom and is the major component in
    11·1 answer
  • Which of these is a process in which the atmosphere interacts with the hydrosphere?
    6·2 answers
  • ILL GIVE WHO EVER HELPS BRAINLISEST ANSWER
    15·2 answers
  • Pooh had a colony of tiggers whose stripes went across the body. His American pen-pal, Yogi, sent him a tigger whose stripes ran
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!