Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA. 
In mRNA 
A - U 
G - C 
T - thymine is absent and is replaced with U - uracil in mRNA. 
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following : 
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG. 
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand. 
        
             
        
        
        
Answer:
1) Oxygen, sugar, water and carbon dioxide are the main starting material and products of both photosynthesis and cellular respiration.
2) The diagram shows that cellular respiration which requires oxygen and sugar is the opposite of photosynthesis which requires water and carbon dioxide. The products of cellular respiration are the starting materials or photosynthesis and the products of photosynthesis are the starting materials for cellular respiration.
 
        
             
        
        
        
The major causes of the greenhouse effect is excessive carbon dioxide gas in the atmosphere. The greenhouse effect is a process that warms the Earth's surface. When the Sun's energy reaches the Earth's atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by green house gases, such as carbon dioxide, water vapor, metahne, nitrous oxide, and ozone. The absorbed energy warms the atmosphere and the surface of the Earth. 
        
             
        
        
        
The answer is pascal's principle hope this helps!
        
                    
             
        
        
        
Educate your family about endangered species in your area. 
Recycle and buy sustainable products. 
Recycle and buy sustainable products. 
Reduce your water consumption.
Volunteer. If you don't have money to give, donate your time