1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
6

How does water help to maintain the body's temperature even when the weather is cold?

Biology
1 answer:
Gala2k [10]3 years ago
3 0
I think the answer is -
when the body experiences a drop in temperature it forces the water molecules to move faster in order to break the hydrogen bonds and release energy as heat.
hope this helps you.


You might be interested in
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
PLZ HELP! WILL GIVE BRAINLIEST!
dusya [7]

Answer:

1) Oxygen, sugar, water and carbon dioxide are the main starting material and products of both photosynthesis and cellular respiration.

2) The diagram shows that cellular respiration which requires oxygen and sugar is the opposite of photosynthesis which requires water and carbon dioxide. The products of cellular respiration are the starting materials or photosynthesis and the products of photosynthesis are the starting materials for cellular respiration.

6 0
3 years ago
What is the major cause of the greenhouse effect? view available hint(s) what is the major cause of the greenhouse effect? exces
Strike441 [17]
The major causes of the greenhouse effect is excessive carbon dioxide gas in the atmosphere. The greenhouse effect is a process that warms the Earth's surface. When the Sun's energy reaches the Earth's atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by green house gases, such as carbon dioxide, water vapor, metahne, nitrous oxide, and ozone. The absorbed energy warms the atmosphere and the surface of the Earth. 
3 0
3 years ago
On what principle are hydraulic systems based?
OLga [1]
The answer is pascal's principle hope this helps!
7 0
3 years ago
Read 2 more answers
Give two ways to preserve and conserve endemic species.​
Jobisdone [24]

Educate your family about endangered species in your area.

Recycle and buy sustainable products.

Recycle and buy sustainable products.

Reduce your water consumption.

Volunteer. If you don't have money to give, donate your time

6 0
3 years ago
Other questions:
  • Some green careers focus on innovations aimed at improving the quality of education. True False
    5·2 answers
  • An example of postzygotic hybrid sterility is A. the birth of a sterile mule for the mating of a horse and a donkey. B. the elab
    7·1 answer
  • Can any kind soul help me ASAP ​
    7·1 answer
  • What is each step in the food chain called?
    8·2 answers
  • A student collected the above data for this experiment. What error did he make? Explain. Mass of the Graduated Cylinder
    7·2 answers
  • Analyze and evaluate how natural selection produces change in populations as opposed to individuals.​
    8·1 answer
  • WHO WANTS TO BE MARED BRAINELEST
    13·2 answers
  • PLS HELP I NEED IT BY 12:00
    8·1 answer
  • What is the data collected during an experiment
    12·2 answers
  • Single stranded with a helix shape
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!