All categories

3 years ago

Compare and Contrast Producers And Consumers In An Ecosystem.

2 answers:

8 0

Producers create food by them selves from the sun but consumers eat the producers they both consume food. But the consumers get less energy than the consumers cause they pass on less energy than they consume hope it helps

Elite trainer

Alex73 [517]3 years ago

5 0

Producers are plants and make food on their own while consumers need food by eating others

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Enzymes can be re used?why?

Anarel [89]

Answer:

Yes. Because:

Explanation:

Enzymes are not reactants and are not used up during the reaction. Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

4 0

3 years ago

A car moving at 10.0 m/s accelerates to 35.0 m/s with an acceleration of 5.00 m/s 2 when passing a

attashe74 [19]

Answer:

It is B

Explanation:

I had this question on my test last week

6 0

3 years ago

Which of the following weighing balances performs measurements in a closed compartment with no air currents to disturb measureme

Neko [114]

Hydraulic balance is the best choice

4 0

3 years ago

What is the purpose of interphase in the eukaryotic cell cycle?

uysha [10]

D. the purpose of nterphase in the eukaryotic cell cycle is cell division

5 0

3 years ago