1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guajiro [1.7K]
3 years ago
14

Light is an example of what in an ecosystem?

Biology
2 answers:
pychu [463]3 years ago
3 0
Light is an example of an abiotic factor. It is also the major energy source. 
eduard3 years ago
3 0

Answer:

A. abiotic factor is the correct answer.

Explanation:

  • Light is an example of an abiotic factor in an ecosystem.
  • abiotic factors are the nonliving factor which include both physical and chemical component in an ecosystem.
  • Examples of abiotic factors are sunlight, temperature, moisture, soil, nutrients, and minerals.

You might be interested in
James Watson and Francis Crick with, the help of Rosalind Franklin and others, determined that the shape of the DNA molecule was
zysi [14]
Shaped like a twisted ladder
3 0
3 years ago
Read 2 more answers
?what are the substances resistin and adiponectin?
Bad White [126]
<span>They are proteins that are secreted from fat cells to help regulate energy balance.</span>
6 0
3 years ago
GIVING BRAINLIEST!!!!<br><br> Name the types of adaptation that animals and plants can have
AnnZ [28]

Answer:  structural, physiological and behavioral adaptations. Most organisms have combinations of all these types.

Explanation:

6 0
2 years ago
Joanna had a small ventricle septal defect (vsd) repaired when she was 3 years old and has no residual cardiac problems. she is
artcher [175]

In the given case, no antibiotic is needed for dental procedures.  

Based on the updated recommendations from the American Heart Association, there is no need to take a precautionary antibiotic prior to dental proceedings for the majority of people.  

It has been suggested by AHA that only those who are at greatest threat of bad consequences from infective endocarditis needs to get the short-term preventive antibiotics prior to routine dental approaches.  

It has been recommended by the AHA guidelines that various of the people who have taken preventive antibiotics in the past no longer need them, these include the individuals with the conditions, like mitral valve prolapse, ventricular septal defect, bicuspid valve disease, rheumatic heart disease, and others.  


8 0
3 years ago
It is true that soil loss caused by wind and water
snow_tiger [21]

Answer:

Running water is the leading cause of soil erosion, because water is abundant and has a lot of power. Wind is also a leading cause of soil erosion because wind can pick up soil and blow it far away. Activities that remove vegetation, disturb the ground, or allow the ground to dry are activities that increase erosion.

4 0
3 years ago
Read 2 more answers
Other questions:
  • HELP PLEASE
    15·1 answer
  • what is the sample that goes through all the steps of an experiment but does not contain the factor being tested?
    9·1 answer
  • Chemical weathering has little effect on: <br> mica <br> feldspar <br> quartz <br> basalt
    9·2 answers
  • A displacement between two bodies of rock is called?
    10·2 answers
  • Traits that are sex linked are carried on
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Water has the ability to dissolve salts and carry dissolved carbon dioxide. How does this action help the human body maintain ho
    5·1 answer
  • Can natural resources be found everywhere on Earth?
    8·2 answers
  • Which of the following describes why phospholipids are better suited to forming the cell membrane than regular fats or steroids?
    15·1 answer
  • How do cellular junctions and receptors maintain homeostasis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!