1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
3 years ago
6

According to some botanists, invasive plants are the second most serious threat, after habitat loss, to native species of plants

and animals and to the maintenance of biologically diverse ecosystems.A. threat, after habitat loss, to native species of plants and animals and to the maintenance of biologically diverse ecosystemsB. threat, after habitat loss, to native species of plants and animals and for maintaining biologically diverse ecosystemsC. threat, after losing their habitat, to native species of plants and animals and also to maintenance of biologically diverse ecosystemsD. threat to native species of plants and animals and for maintaining biologically diverse ecosystems, after habitat lossE. threat to native species of plants and animals as well as to maintaining biologically diverse ecosystems, after losing their habitat
Biology
1 answer:
Nataliya [291]3 years ago
8 0

Answer: option A - threat, after habitat loss, to native species of plants and animals and to the maintenance of biologically diverse ecosystems

Explanation:

Invasive species refers to organisms that appears at a particular habitat that has just undergone an environmental unfavorable condition.

These INVASIVE SPECIES poses THREAT to the native organisms, because they usually possess:

better resistance to disease,

higher reproductive rate, etc.

So, even when native organisms migrate or dies, Invasive species REMAINS. As a result, they threaten the maintenance of a biologically diverse ecosystem

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Complete hydrolysis of a nonapeptide gave 3 ala, 2 phe, 2 asp, gly, and ser. Reaction of the nonapeptide with Sanger's reagent (
Wewaii [24]

Answer:

Alanine is obtained as the first amino acid, taking into account that the reaction with the Sanger reagent hydrolyzes N- (2,4-dinitrophenyl) alanine. thus with the fragments of the partial hydrolysis they are organized to create a polypetidic chain

ala-asp-gly-ala

gly-ala-phe

phe-be-wing

be-wing-phe-asp

We obtain that the correct sequence of the peptide is "ala-asp-gly-ala-phe-ser-ala-phe-asp"

7 0
3 years ago
What do you think would happen to the lion
IRINA_888 [86]

Answer:

The lion population would decrese

Explanation: The more hyenas would mean more competion for food which would lead to lions dieing off due them not being able to get food hope this helps god bless

4 0
3 years ago
Airway management can be challenging in patients with down syndrome because their:
elena-14-01-66 [18.8K]
Because their TEETH ARE MISALIGNED AND THEY USUALLY POSSESS LONG TONGUE. Respiratory illness is common in people who have down syndrome and their unique airway anatomical factors makes airway management difficult during respiratory distress. For instance, they have narrower upper airway and smaller trachea.
7 0
3 years ago
Which type of metamorphic rock forms when limestone is exposed to heat and pressure?
tatyana61 [14]

Answer:

marble

Explanation:

Its right on ed

7 0
3 years ago
Read 2 more answers
Other questions:
  • How do hormone disruptors affect the endocrine system?
    8·1 answer
  • Explain how soil is important to animal life
    14·2 answers
  • For a prokaryotic gene, basal transcription is defined as
    7·1 answer
  • What are the two main components of blood?
    7·1 answer
  • If i want to be a genecist is it necessary that i take maths in 11 and 12 class?
    6·1 answer
  • ATP synthesis in both chloroplasts and mitochondria involves the process called . 2. In both cellular respiration and photosynth
    11·1 answer
  • Which activity is most likely a result of a sudden, unexpected change in the<br> environment?
    11·1 answer
  • What is the elephant getting when the bond is broken in sucrose?<br>​
    8·1 answer
  • Which of the following statements is true in humans?
    7·1 answer
  • During meiosis, when does the ploidy (number of sets of chromosomes) get reduced from diploid (2n) to haploid (n)?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!