1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aliya0001 [1]
3 years ago
10

Breaking down glucose to provide energy in the form of atp for metabolic processes is called?

Biology
2 answers:
Deffense [45]3 years ago
6 0

Breaking down glucose to provide energy in the form of atp for metabolic processes is called? glycolysis

weqwewe [10]3 years ago
4 0

Cellular respiration

You might be interested in
NEED HELP ASAP PLEASE Describe the controversy surrounding dissociative identity disorder as a diagnosis and explain how stress
g100num [7]

Answer:

um i need help on this 2 !!!!

Explanation:

8 0
3 years ago
Please answer the 1st question.
CaHeK987 [17]

Answer:

Explanation:

lady bug

6 0
3 years ago
Determine the level of measurement of the variable with explanation.
Pavlova-9 [17]

It has properties of the ordinal level of measurement and the differences in the values of the variable have meaning. A value of zero in the interval level of measurement does not mean the absence of the quantity. Arithmetic operations such as addition and subtraction can be performed on values of the variable is called interval.  While nominal the values of the variables name, label or categorize. In addition, the naming scheme does not allow values of the variables to be arranged in a ranked or specific, order. 

6 0
3 years ago
What are the 3 energy molecules produced during the Krebs Cycle/Citric Acid Cycle?
Elden [556K]
The three molecules are Nadh, Fadh and ATP
6 0
3 years ago
Read 2 more answers
What is a thesis statement?
Umnica [9.8K]
A. A statement of purpose
7 0
3 years ago
Other questions:
  • Translation takes place in the..
    12·2 answers
  • The three types of ocean floor sediments are terrigenous, biogenic, and _____.
    12·1 answer
  •  Which statement BEST describes why warm ocean currents are usually surface currents?
    9·1 answer
  • Other than bacteria, which factor leads to nitrogen fixation
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • AM I CORRECT??
    15·2 answers
  • What role does dna replication play in the cell cycle
    13·1 answer
  • In peas, axial (A) flower position is dominant to terminal (a), tall (L) is dominant to short (l), and yellow (Y) is dominant to
    14·1 answer
  • Which of the following would be an example of a positive externality?
    6·1 answer
  • The blazing star borer moth and the blazing star plant form a relationship. The adult moth lays eggs at the
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!