1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
abruzzese [7]
4 years ago
15

According to the endosymbiotic hypothesis, why did the large cells not destroy the small aerobic cells they engulfed? A.because

they were so tough B. because they provided energy C. because they were parasites not food D. because they did not know they were there
Biology
2 answers:
allsm [11]4 years ago
6 0

B i think because it sounds like the most logical answer.

Lyrx [107]4 years ago
4 0

Answer:

i took the test and i chose the answer B.

Explanation:

You might be interested in
Unwanted dumping of chemicals has caused pollution in a particular region, leading to a decrease in the number of insects. Blueb
snow_tiger [21]
It could have a decrease of the food chain and not just effect animals but people
6 0
3 years ago
Read 2 more answers
Two consecutive even positive integers have a product of 2,400. What is the smaller of the two numbers?
Flura [38]

Answer: <u>Option C; 48</u>

Explanation:

Let one number = x

Other number = x+2

According to question-

[x] [x+2] = 2400

x^{2} + 2x - 2400 = 0

Solving this equation, we get-

[x - 48] [x - 50 ] = 0

x = 48 or 50

Since 48 is the smaller number here, answer is option C

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Atmospheric pressure decreases with increasing _________.
Elena-2011 [213]
With increase in altitude atm pressure decreases... :)
3 0
3 years ago
Which property of water makes it helpful to use in car radiators?
nexus9112 [7]

Answer:

Specific heat capacity is the property of water that makes it useful in car radiators.

Explanation:

Water has a high specific heat capacity. So it is used as a coolant in car radiators and helps maintain temperature of car engines.

4 0
3 years ago
Other questions:
  • Where are ganglia of the parasympathetic division located?
    13·1 answer
  • What happens to a cell if it is interrupted during mitosis
    7·1 answer
  • all of the following are nonspecific defense responses made by the human body except? b. mucus produced in the nasal and oral pa
    10·1 answer
  • Alexander Fleming accidentally discovered the antibiotic properties of the Penicillium mold in 1928. True or False
    15·1 answer
  • Which cell organelle provides instructions to the Golgi apparatus on where the substances should be delivered?
    8·1 answer
  • What is the role of hydrogen bonds in waters specific heat?
    6·1 answer
  • What are the masses of gray matter that lie deep within the cerebral hemispheres and that are responsible for regulating intensi
    10·1 answer
  • What is being used to carry the new gene into the bacterial cell?
    11·1 answer
  • Mutations that are not helpful usually __________________.
    12·2 answers
  • After concluding his research, which statements would Virchow agree with? CHECK ALL THAT APPLY.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!