Answer:
Option B, chemical energy to thermal energy
Explanation:
All living organism feed on food that contains energy in the form of chemical energy. Once the food is intake and processed for fulfilling energy requirement of all metabolic processes with in a cell, the remaining energy is released as heat (thermal energy). Thus, an amoeba while consuming a sugar molecule converts chemical energy with in the sugar to thermal energy in the form of energy molecules.
Hence, option B is correct
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The species was a keystone species.
Keystone species are the species that ''hold the ecosystem together''.
They have an important role in the trophic networks (food chains) and often they can even afflict changes in the abiotic part of the ecosystem (change the composition of soil, purify the water, lower the effect of the wind etc)
Therefore, when a keystone species is removed it affects greatly the whole ecosystem.
Yes probely is but just try
Glucose In the blank, they are called monosaccharides
