1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
3 years ago
10

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 10 million years. Examine th

e DNA segments from two different species: Species A: CTTAAGCTAGTAAGGACC Species B: CATAAGTTAGTAAGGTCC Using this example, explain how this information can be used to determine how long ago these two species shared a common ancestor.
Biology
2 answers:
Assoli18 [71]3 years ago
6 0

Answer:

We would use the molecular clock in order to determine how long ago these species shared an ancestor. If we compare the DNA sequence of the two species, we would find that three mutations have taken place. Thus, 30 million years would have passed to evolve three mutations. Now, we divide 30 million by two because there are two species, and we can infer that they must have shared a common ancestor around 15 million years ago.

lawyer [7]3 years ago
4 0

Answer:

The correct answer would be 30 million years.

The molecular clock is a technique used to determine the time when the two species diverged from a common ancestor. It uses the mutation rate to determine the same.

Mutation rate is the rate at which a number of mutations take place in a given unit time.

For example, the mutation rate in a given question is one mutation per 10 million years, that is, one nucleotide is mutated in 10 million years.

If we compare the DNA sequence of the given two species, we would find that three mutations have taken place.

Species A: CTTAAGCTAGTAAGGACC  

Species B: CATAAGTTAGTAAGGTCC  

Thus, 30 million years would have passed to evolve three mutations.

Hence, they must have shared a common ancestor around 30 million years ago.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
18. Which of the following is anatomical evidence theat two organisms have common ancestors?
Jobisdone [24]

Answer:

organisms have similar bone structure.

Explanation:

please make me brain list answer

4 0
3 years ago
Which statement best explains how the structure of atp helps provide energy to the cell?
Alekssandra [29.7K]

Answer:

ATP contains energy in the chemical bonds between its phosphate groups, best explains how the structure of ATP helps provide energy to the cell.

Explanation:

brainly.com/question/2456485

4 0
3 years ago
True/False, all organisms have a form of waste removal. Explain your answer with specific examples.
Tcecarenko [31]
I believe the answer is true. Humans have a digestive track, which removes unwanted matter from the body.
3 0
3 years ago
Read 2 more answers
What is a genetically modified organism?
a_sh-v [17]

Answer:

A living organism whose genes have been purposefully altered

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which enzyme is not working correctly if the dna had more than nomal level of mutations?
    8·1 answer
  • Both mitosis and meiosis begin with a diploid cell that contains replicated chromosomes.
    8·1 answer
  • Hemophilia is a sex-linked trait. A hemophilic male produces offspring with a carrier female. What are the chances that the fema
    15·2 answers
  • What kind of community does the photograph show
    14·2 answers
  • True or false? narcotic analgesics can depress respiration.
    5·2 answers
  • What type of symmetry does Annelids, Mollusks, Arthropods, and Vertebrates have Radial Bilateral Or none?
    6·1 answer
  • What is the thing in the back of your throat called
    6·1 answer
  • Finish the sentence: The thyroid gland releases Hormones that control your________
    8·1 answer
  • The structures of the dermal and vascular systems work together to transport and provide materials essential for photosynthesis.
    5·1 answer
  • Which of the following is not a possible pollutant?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!