1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zimovet [89]
3 years ago
5

eight children share a bag of candy Conataning 39 pieces. about how many pieces of candy will each child get

Biology
2 answers:
iris [78.8K]3 years ago
7 0

about 4. 39/8=4.85, so there will be a couple pieces left over

Tatiana [17]3 years ago
3 0
About 4.87 and like said before there will be extra
You might be interested in
When substances are put together, broken into their most basic particles, and spread evenly through another substance they form
Colt1911 [192]
They form a Solution.
4 0
2 years ago
The subunit (organelle) of the sperm that supplies the energy for motion is _____.
Andreyy89
The answer is the mitochondria
8 0
3 years ago
Read 2 more answers
Why would farmers plant alfalfa that has less economic value
arlik [135]

answer:

because it benefits the soil. the long alfalfa stand life also gives the soil a chance to rest from frequent field crop rotations, helps provide nitrogen for subsequent crops, and improves soil tilth. this helps prevent pesticide and sediment movement to natural waterways.

good luck :)

hopefully, this helps

have a great day !!

8 0
3 years ago
If a plant has both male and female reproductive organs it is:<br> a) Monoecious.<br> b) Dioecious.
jasenka [17]

Answer:

(a) Monoecious

Explanation:

Monoecious refers to plants which have both male and female reproductive organs. Most of the plants have both male and female reproductive organs.

Dioecious describes a plant group that have distinct male and female plants. monoecious is also known as single house as male and female are found in single individual and dioecious is also known as double house as it has distinct male and female plants  

7 0
3 years ago
An important characteristic of urine is its specific gravity or density, which is ________.
dlinn [17]
Slightly higher than water.
5 0
3 years ago
Other questions:
  • You have learned that tape or adhesive bandages must be removed carefully from the skin on patients who are elderly to avoid tea
    10·1 answer
  • For polar bears what actions can people take to help solve this global issue? Explain why your solution would be effective? (Mak
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The stems and for called bromelai vegetables brou and fruits of pineapple plants contain a group of protein-diresting enzymes co
    9·1 answer
  • Bud, age 10, was born with short fingers, slanted eyes, and a protruding tongue. he is moderately intellectually disabled. his p
    10·2 answers
  • Las celulas ecuariotas se caracterizan principalmente por presentar
    8·1 answer
  • The products of cellular respiration are the reactants of photosynthesis.<br> TRUE<br> FALSE
    9·1 answer
  • I
    7·1 answer
  • Math solve questions​
    7·1 answer
  • What is the mean (average) of 101.9, 90.9, and 89.3?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!