1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
6

Which is not an example of a "living" life process?

Biology
2 answers:
WITCHER [35]3 years ago
8 0

Answer:

Nutrition

Explanation:

--------------------

Delvig [45]3 years ago
6 0
The answer is D please mark me brainliest
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Explain how the scales on some fishes can be used to estimate the age of those fishes
DedPeter [7]
Amount of wear, and how long they are may contribute with age and maybe even coloration and pigment. 
3 0
3 years ago
What happens during heat transfer within earth
hammer [34]
Um lets see so first coold air comes pushing awah heat to another area. i tihnk

7 0
3 years ago
Read 2 more answers
Babies with very low or very high birth weight are less likely to survive. The graph shows the percentage of babies born at diff
Crazy boy [7]

Answer: c

Explanation:

4 0
3 years ago
Read 2 more answers
Please help! I cant figure it out! Does anyone know ? If the answer is correct ill mark you as the best answer!!
Triss [41]

Answer:

the cell wall

Explanation:

cell membrane is not rough and it doesn't support or protect the cell.

cytoplasm is the inner environment of the cell that includes organelles and nutritions. it's not rough and doesn't support or protect the cell.

6 0
3 years ago
Other questions:
  • The characteristics of an organism are called____
    13·1 answer
  • Describe how proteins synthesized in a cell are packaged, modified, and exported out of the cell. Be sure to include the contrib
    10·1 answer
  • What is the process that turns water vapor into liquid, which causes the formation of a cloud.?
    11·1 answer
  • Assume the potato cubes are cells. which cube would be most efficient at moving materials into and out of the cube? briefly expl
    12·1 answer
  • Why are marshes more productive than bogs
    11·2 answers
  • The superior vena cava empties what
    13·2 answers
  • What are the respiration organs of the following fishes mamals insect lizzard​
    11·1 answer
  • !!! Please answer this ASAP!!!
    7·1 answer
  • Acrostic poem -diffusion
    12·1 answer
  • Which is the best description of a temperate climate zone?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!