1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cestrela7 [59]
3 years ago
15

A forest was cleared to build a road. Which two would be most likely effects on the ecosystem

Biology
1 answer:
Ilia_Sergeevich [38]3 years ago
8 0

Answer:

"Animals will migrate to other regions in search of food" Whenever an area in a forest is cleared up to build a road or because of any other reason the habitat of the animals residing there is destroyed.

Explanation:

Science

You might be interested in
A. What are general/biological functions of proteins in human body/cells/organism?
iogann1982 [59]

Answer:A) proteins are useful as enzymes, hormones etc.

B) the building block of protein are amino acids

Further explanation below

Explanation: A) proteins are polymers formed by several chains of amino acids. They occur in living tissue and form 50 -- 60% of the total dry mass of the living cell. Proteins found in the membrane are used as structural integrity. Some proteins are catalytic in nature and are such are used as enzymes. They also occur as hormones. Proteins help in the transport of substances across the cell membrane, when they are found in the cell membrane.

B) the building block of protein are amino acids. They undergo condensation reaction to form proteins.

The structure of amino acid is in the attached photo.

R = the group that determine the name of the amino acid. It may be a hydrogen atom,an alkyl, an aryl, or carboxyl group.

H2N = the amino group

COOH = the carboxyl group

C = the alpha central carbon to which other groups are attached.

8 0
4 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
______ weathering is the breakdown of a rock into smaller pieces by freezing, thawing, plant growth or the actions of animals.
Oliga [24]
Mechanical  i think it is 
8 0
4 years ago
Read 2 more answers
Which of the following describes how blood helps to maintain homeostasis by working with the immune system?
sweet [91]
The first one,  <span>By having white blood cells to attack pathogens. this is because blood also has white blood cells. and the immune system has pathogens. so the blood cells help attack pathogens.</span>
5 0
3 years ago
Where are rain gauges located
12345 [234]

usually this is the measuring device of amount of rain fall.

you can buy these, but most of the time meteorologists will have these to measure the amount of rain fall

5 0
3 years ago
Other questions:
  • An area of forest that experiences very little change in species composition is a?
    12·1 answer
  • How can u identify a prokaryotic cell
    13·1 answer
  • What is the function of DNA in the process of protein synthesis?
    9·1 answer
  • How does earth’s rotation affect our view of stars?
    11·1 answer
  • What is one organelle that all prokaryotic and eukaryotic cells have? A: ribosomes B: cell wall C: vacuole D:nucleus
    8·2 answers
  • Please help me answer this 5 questions i mark you as brainlist
    9·1 answer
  • Mutations that neither benefit nor harm the organism have effect on the organism's survival.
    5·2 answers
  • Ozone layer removed how would it effect temp
    6·1 answer
  • Name:
    14·1 answer
  • Which of the following best describes a characteristic of DNA that makes it useful as hereditary material?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!