1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
2 years ago
5

Would an animal cell be able to survive without a mitochondria

Biology
1 answer:
taurus [48]2 years ago
5 0
Mitochondria important for the cell that can't survive without it but blood cell is an exception. Blood is a tissue in animals so RBCs are animal cells and don't have mitochondria
You might be interested in
A population of pigs lives on an island together with burrowing termites. Pigs that have the longest snouts tend to survive bett
alexandr402 [8]

Answer:

Explanation:

directional selection

4 0
3 years ago
Read 2 more answers
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
2 years ago
list features that are found in eukaryotes but not prokaryotic and their advantages provided by these features
lisov135 [29]
The main differences are that eukaryotes have membrane-bound organelles and the nucleus, which enables them to create much more complex multi-cellular organisms, which is impossible for the prokaryotes.

7 0
3 years ago
One way that mining for mineral resources damages land is by
RUDIKE [14]
The correct option is D.
Mining for mineral resources is an intensive task that involves disturbing and disrupting the lands where the minerals are found. The process of mineral exploration and eventual mining cause great disturbances to the affected land and one of the damages done to such land is great increase in soil erosion. 
7 0
3 years ago
Read 2 more answers
Cutting down vast tracks of rain forest may result in a loss of all the following environmental effects, except which one?
Harrizon [31]
 Your answer would be oil
3 0
3 years ago
Read 2 more answers
Other questions:
  • At 1000 hours, a client with a diagnosis of pain disorder demands that the nurse call the health care provider (hcp) for more pa
    5·1 answer
  • Living off Earth's natural income may be compared to _____. a. taking someone else's assets without their knowledge b. losing a
    8·1 answer
  • When a yoruba sculptor created a human form, he or she made this body part disproportionately large:?
    11·1 answer
  • What information about the structure of DNA was obtained from X-ray crystallographic data?
    6·1 answer
  • Photosynthesis occurs
    12·2 answers
  • Antibiotic resistance is becoming more common in disease-causing bacteria because: (select all that are correct)
    14·1 answer
  • Which of these has the greatest density ?
    10·1 answer
  • Shows its specific trait when both parents pass the gene to the offspring *
    9·1 answer
  • Which diagram best illustrates the flow of energy in an ecosystem?
    7·1 answer
  • Which statements describe the importance of the nitrogen cycle to living things? Select two options. It provides a source of wat
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!