I'd say zoology.
Zoology is the study of animals, generally speaking, and since birds are animals, the study of these fall into the field zoology. The study of birds though, is called ornithology.
Hope it helped,
BioTeacher101
Chargaffs rules states that dna from any cell of all organisms should <span>have a 1:1 ratio (base Pair </span>Rule<span>) of pyrimidine and purine bases and, more specifically, that the amount of guanine is equal to cytosine and the amount of adenine is equal to thymine.</span>
The Pharynx is the passageway way for food
The Larynx is the passageway for air
<h3>Pharynx </h3>
The Pharynx is a long tube that is located in the throat region, it helps in the smooth passage of food from the mouth and down to the stomach where it is needed for body metabolism
<h3>
Larynx</h3>
The larynx helps in the free flow of air, it is sometimes called the voice box. It plays a vital function by blocking the windpipe from taking in food particles
For more information on Pharynx and larynx, please see the link below
brainly.com/question/9064940?referrer=searchResults
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
