1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
14

Connective tissue extracellular matrix is composed of ________. cells and fibers fibers and ground substance ground substance an

d cells all organic compounds
Biology
1 answer:
wariber [46]3 years ago
5 0
Connective tissue extracellular matrix is composed of fibers and ground substance. The cells of connective tissue are embedded in a great amount of extracellular material. The matrix is secreted by the cells and consists of protein fibers embedded in an amorphous mixture of large protein-polysaccharide (highly viscous proteoglycans) molecules. it also contains water and minerals.
You might be interested in
What are 2 factors that would limit population growth in marine life
ZanzabumX [31]
Factors such as temperature, water salinity, amount of light, nutrient levels, and saturation state are all environmental conditions that can suppress the growth of marine life.
6 0
3 years ago
Read 2 more answers
a plants water supply is now deeper in the ground. by which process do the roots grow longer to reach the water? a. photosynthes
pantera1 [17]
Mitosis, since it involves the process of splitting into two daughter cells.
5 0
3 years ago
Read 2 more answers
Please answer ASAP!
alukav5142 [94]

Part A:

<span>If early conditions of primeval earth had ammonia, methane, hydrogen in its atmosphere, then it is possible that amino acids such as glycine, α-alanine, and β-alanine may have been spontaneously formed from chemical reactions spurred by energy from lightning.</span>

<span>Their hypothesis was that the early conditions of primeval earth favored the spontaneous formation of organic molecules, from inorganic precursors, that may have been the origin of life. This theory is called abiogenesis. </span>

 

Part B:

<span>Miller Urey put methane, ammonia, hydrogen gases in a glass flask and a pool of water at the bottom of the glass flask. The flask was heated moderately to simulate the hot conditions then. Sparks were also occasionally induced in the flask to mimic lighting. The flask was then cooled slowly to simulate cooling of earth over time.After one day, they found the presence of some amino acids (glycine, α-alanine and β-alanine) was discovered in the water in the flask</span>




5 0
2 years ago
Alcohol and other psychoactive drugs affect which parts of the brain? #1. primitive brain #2. reasoning center of the new brain
pogonyaev
The part of the brain which is affected is reasoning center of the new brain. Drinking alcohol also decreases motor function and slow reaction time, this is why when a person is drunk, he/she may not be able to stand or walk a straight line. Psychoactive drug or psychotropic substance is a chemical substance that acts primarily upon the central nervous system where it alters brain function resulting in temporary changes in perception, mood, consciousness and behavior.
8 0
3 years ago
What is a nucleus like in real life?
daser333 [38]
A real nucleus example like a Boos from a Company 
The DNA i like cook cookies 
5 0
3 years ago
Other questions:
  • 14. How can any rock be turned into igneous rock?
    5·1 answer
  • One of the primary functions of the digestive system is ?
    15·1 answer
  • In pea purple flowers are dominant over white flowers. If two herterozygous purple-flowered plants are crossed with each other t
    13·1 answer
  • When bacteria are inoculated into a new sterile nutrient broth, their numbers don’t begin to increase immediately. Instead, ther
    9·1 answer
  • During the digestion of foods,large molecules are broken down into smaller molecules
    8·1 answer
  • The structure that forms a bony bulge on the distal, lateral surface of the lower leg is the ________.
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Only bones form fossils<br><br> true or false <br><br> quick pls !!
    9·1 answer
  • Anyone wanna add me on Nintendo switch online?????​
    15·1 answer
  • From your perspective, how does the frequency of the waves appear to change as the airplane approches and then passes you ?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!