1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Wewaii [24]
3 years ago
12

Match the functions to the cell types ? Contraction and relaxation. Conducting electrochemical signals Fighting diseases Carryin

g genetic material
Biology
1 answer:
dsp733 years ago
4 0

Answer:

Following are the cell types related to the functions.

1- Contraction and relaxation are caused by smooth muscle cells. During contraction, smooth muscles become short in length and vice versa.

2- Neuron cells ( soma, axon, and dendrites) conduct electrochemical signals.

3- Lymphocytes, also known as white blood cells protect the body against different diseases.

4- In a cell, DNA is found in the chromosomes which are responsible for carrying the genetic material generation after generation.

You might be interested in
Please tell me answers I am given you brainliest ​
qwelly [4]

Answer:

Q2->They all form acids when combined with hydrogen. They are all fairly toxic. They readily combine with metals to form salts.

Q3->Because their outermost orbit is complete.  In Mendeleev's original periodic table there was no place reserved for noble gas.  They were discovered in end of 19th century.  So Mendeleev created zero group without disturbing original periodic table.

Explanation:

6 0
3 years ago
Dorm residents experience what secondary effects of heavy drinking? select all that apply.
IceJOKER [234]
Dorm residents experience the following secondary effects of heavy drinking:
interrupted studies, babysitting a drunk room mate and unwanted sexual advances,
Secondary effects of heavy drinking refers to those behaviors that a person  person exhibited as a result of heavy drinking and how those behaviors affect those around him.<span />
4 0
3 years ago
How would clearing up pollution help address climate change?
xxTIMURxx [149]
It help because if the the plouttion is because of water it will rain
6 0
3 years ago
Answer the question !!! What improvements could I make if I wanted to have a better controlled experiment ? And think about some
iris [78.8K]
You could have made sure the books were the same weight and your friends could have done it at the same time as you
3 0
3 years ago
The greatest cause of the worldwide loss of species is ________.
Bad White [126]
The greatest cause of the worldwide loss of species is human activity. I think
7 0
4 years ago
Read 2 more answers
Other questions:
  • If you wanted to watch a cell swim in a drop of pond water, which microscope would be best to use? A.) Scanning Electron Microsc
    14·2 answers
  • Porque el huevo es una celula
    8·1 answer
  • The movement of tectonic plates in two locations is described below: Location A: Tectonic plates push together Location B: Tecto
    10·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What might happen to the food web below if the number of phytoplankton drastically decreased? The small fish and wading birds wo
    12·2 answers
  • 9. If you conducted the analysis portion of Experiment 2, you calculated
    12·1 answer
  • What is a biome. in your own words
    10·2 answers
  • Using your understanding of diffusion, how do you think oxygen from our lungs is transported to our red blood cells?​
    15·1 answer
  • 3.<br> What two molecules are produced during Photosynthesis?
    15·2 answers
  • Mitosis continues resulting in a mass of about 32 smaller cells. What do we call this mass of cells?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!