1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
6

Canaliculi structure of​

Biology
1 answer:
vovangra [49]3 years ago
5 0

Bone canaliculi are microscopic canals between the lacunae of ossified bone. The radiating processes of the osteocytes (called filopodia) project into these canals. These cytoplasmic processes are joined together by gap junctions. ... In cartilage, the lacunae and hence, the chondrocytes, are isolated from each other.

You might be interested in
The cell below has a membrane that is permeable to water but impermeable to salt. The concentration salt in the cell is 5%. What
Sidana [21]
If you could tell me what cell it would be easier. Sorry I have to post it on Answer but I't does not show the commentary or whatever you guys call it.
5 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What are the effects of Speciation & Extinction on biodiversity​
Sunny_sXe [5.5K]

Answer:

Specitation increases biodiversity, while extinctions decrease biodiversity.

Explanation:

Biodiversity is the variety of life on Earth or some specified geographic area of the planet; the diversity of life occurs at the genetic level, at the species level, at the ecosystem level, and in evolutionary lineages.

6 0
3 years ago
Read 2 more answers
Species can vary in several ways. Which of the following is one of Darwin's ideas that was accepted by most scientists of his ti
fenix001 [56]

Answer:

Due to the large number of fossils being discovered at that time Darwin proposed that species change over long periods of time.

Explanation:

The theory of Darwin was that the species change in accordance to their environment, thus they develop advantageous traits so that they can be more competitive.

8 0
4 years ago
Which sequence correctly increases complexity in the level of biological organization?
EleoNora [17]

Answer:

the correct answer would be

A. atoms, molecules, cells, tissues, organs

7 0
4 years ago
Other questions:
  • Which term best describes the rate at which glacial erosion takes place
    5·1 answer
  • if there is a low concentration of sucrose to water (so there’s more water than sugar in a solution) outside of a cell, will the
    15·1 answer
  • Explain the main difference between exponential and logistic growth
    12·1 answer
  • What is the function of the cell wall?
    7·1 answer
  • which of the following is true about imprinting? a. it is often used in the training of adult animals. b. it always involves the
    11·1 answer
  • While walking in the woods, a student encounters a brightly colored organism with a flat, branching structure growing on a decay
    15·1 answer
  • Structures that are similar in different species show common ancestry
    12·1 answer
  • 10 points!! <br> Please help
    13·1 answer
  • Nuclei of atoms that make up a newborn baby were made in the
    8·1 answer
  • After researching the possible effects of music, Elaina proposes that if people listen to faster-paced music, their pulse rates
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!