1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lesechka [4]
3 years ago
5

Farmers consider pesticides and fertilizers necessary to ensure successful farming. What problems are caused by the use if these

agricultural pollutants?
The increased nitrates from the fertilizers leech into the water and cause algal blooms, which take oxygen out of the water and this suffocates fish.
Pesticides seem to pose no environmental problems.
The increase greenhouse gases.
Biology
2 answers:
xenn [34]3 years ago
8 0

The answer is <span>The increased nitrates from the fertilizers leech into the water and cause algal blooms, which take oxygen out of the water and this suffocates fish.</span>. 


Algae blooms are the consequence of large amounts of farm fertilizers in the rivers, which increases nitrates level in the water. Algae use the presence of increased nutrients and enhance their own growth. It is known that they produce an oxygen in the photosynthesis, so it is not a problem while they are still alive. But when these organisms die, their decomposition begins. For the process of decomposition, the oxygen is needed and ultimately it will be depleted from a body of water. This could lead to the death of aquatic animals, such as fish, that depend on oxygen.

Murljashka [212]3 years ago
5 0

Answer:

A. The increased nitrates from the fertilizers leech into the water and cause algal blooms, which take oxygen out of the water and this suffocates fish.

You might be interested in
Help what is A and B
Leto [7]

Answer:

A is carbon dioxide and B is ATP

Explanation:

hope this helps

8 0
3 years ago
Read 2 more answers
How does science help society?
alexgriva [62]

Answer:it can help with budget

Explanation:

If you use science and think about it science can help society if you use it correctly like if you use it to save water or to stop clumpier Change if you stop that society in my opinion would change greatly in a good way

6 0
2 years ago
Read 2 more answers
Summarize: In your own words, describe what heredity is and how it works in mice.
Tasya [4]

Answer:

Heridity is genitically passing on mental and physical traits.

Heridity on mice is the same as it in is humans but you study the coat or flur of them.

Explanation:

8 0
3 years ago
1. **How does the amount of carbon the US emits compare to other countries?
worty [1.4K]

Answer:

5.1 billion metric tons of carbon is emitted by U.S as compared to other countries which emits about 32.5 billion metric tons of carbon.

Explanation:

U.S emits about 5.1 billion metric tons of carbon in the atmosphere which contribute in air pollution also helps in rising the temperature of the earth atmosphere because carbondioxide is a green house gas which increases the earth temperature. The main reason of high amount of carbon emission is the high number of industries and more fossil fuels is burnt in the engines of vehicles.

4 0
3 years ago
Cells contain genetic material.<br>TRUE<br>FALSE<br>​
Mnenie [13.5K]

Answer:

True

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • What tools/techniques do scientists use to collect the data that is used to predict a hurricane's path?
    13·2 answers
  • During the hot dry season, some species of molluscs move to shaded areas or climb structures to escape the heat from the ground.
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • How are the nervous system and endocrine system similar? how are the nervous system and endocrine system similar? the nervous sy
    13·1 answer
  • What is the basic form of matter which cannot be broken down any further
    10·1 answer
  • How do different organisms affect enzyme rates
    14·1 answer
  • Water molecules made by living things become part of the water cycle through
    11·1 answer
  • 10 points
    13·1 answer
  • A
    15·1 answer
  • Imagine a population evolving by genetic drift, in which the frequency of allele k is 0.8. what is the probability that at some
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!