1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
13

An emergency reaction when dealing with a threat often includes sympathetic nervous system arousal and the mobilization of one's

energy. this is best illustrated by
Biology
1 answer:
Vladimir79 [104]3 years ago
3 0

An emergency reaction when dealing with a threat often includes sympathetic nervous system arousal and the mobilization of one's energy. this is best illustrated by - the fight or flight response.

A fight or flight response, also called hyper arousal is a physiological reaction which occurs in response to a perceived harmful event, attack, or threat to survival.

You might be interested in
What are the two types of density change?
Anton [14]
One type of density change is mass over volume.
4 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which word best describes both texts I will mark brainiest
soldier1979 [14.2K]

Answer:

Informative

Explanation:

Both texts provide information about mucus and its importance to the human body, as well as its origin.

5 0
3 years ago
In 1969, whittaker proposed moving the __________ from the kingdom plantae to a separate kingdom due to structural and metabolic
wolverine [178]
In 1969, whittaker proposed moving the prokaryotes from the kingdom plantae to a separate kingdom due to structural and metabolic differences.
4 0
3 years ago
Read 2 more answers
How many tsunamis does the andes mountains have per year?
dedylja [7]

Answer:

1,000 times a year

Explanation:

6 0
3 years ago
Other questions:
  • What are the characteristics of the cell membrane
    11·2 answers
  • Cells in organisms need food, air, and waste removal. How are these needs met? A. Each cell must specialize in all of these func
    5·2 answers
  • The time period from conception to birth is called
    8·2 answers
  • What is radiation
    9·2 answers
  • wasp pollinating a plant in exchange for food is an example of Group of answer choices A) both a service mutualism and a habitat
    6·1 answer
  • Describe the events that might occur if there isn’t new crust formed.
    15·1 answer
  • Eutrophication occurs when excess nutrients are supplied to a region, leading to an algae bloom and ultimately _______
    10·1 answer
  • Bacteria, viruses, protists, parasites, and fungi can all cause disease and can be referred to as ______. antibodies macrophages
    12·1 answer
  • SOMEONE PLEASE HELP ME OUT WITH THIS !!!
    10·1 answer
  • What's the sum of the mass added by the proportions use the chart
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!