Answer:
Because food kept at room temperature is somewhat exposed to air, and sometimes, the air can contain dangerous chemicals that were perhaps accidentally released, whereas food in the refrigerator doesn't apply to that problem.
Explanation:
Hope this helps, and please mark as brainlest! :)
Answer:
The below options will complete the question
Select one:
a. Gap repair synthesis
b. Mismatch repair
c. Direct repair
d. Nucleotide excision repair
Our answer is surely A.
a. Gap repair synthesis
Explanation:
Alleles of gene B differ by 6 bps and are seeming close to each other among the 1123 bp within the particular gene, favouring the gap repair synthesis.
In the gap repair synthesis, a double stranded break is formed at a homologous chromosome with a small part of the gene or the 6 bps of the recessive allele
being digested away.
Strand invasion and a D-loop formation is followed by the new region being occupied by the dominant B allele to yielding dominant B allele in both chromosomes.
The gap repair synthesis allows the 6bps to be converted to the dominant B from the recessive b when in proximity/being close together.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer and Explanation:
Enzymes are organic catalysts which are protein in nature. There are two types of naming enzymes:
<h3>Trivial naming</h3>
This method involves giving enzymes names based on the names of the persons who discovered them. The names of such enzymes end with the suffix-in, for example, pepsin, trypsin. Some of these names have been retained to date.
Enzyme Nomenclature by Enzyme Commission
This is the modern method of naming enzymes. The suffix-ase is added to the substrate or the reaction which the enzymes catalyses. Every enzyme code consists of the letters "EC" followed by the enzyme. For example
EC 1 oxidoreductases- oxidoreduction reactions
EC 2 transferases- transfer of a functional group
EC 3 hydrolases- catalyse hydrolytic cleaving
EC 4 lyases - adding groups to double bonds. e.g., C-C,C-O
EC 5 isomerases - catalyse structural changes in a molecule
EC 6 ligases - joining of two molecules
Peripheral nervous system
