1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
9

Endotoxin is:

Biology
1 answer:
wlad13 [49]3 years ago
6 0
I think is C idk why
You might be interested in
List the 4 structures that all<br> cells have.
stealth61 [152]

Answer:cell walls, cell membrane, mitochondria and nucleus

hope this helps(:

Explanation:

8 0
3 years ago
What are the 2 ways water can enter the atmosphere
pishuonlain [190]
Heat from the Sun causes water<span> to evaporate from the surface of lakes and oceans. This turns the liquid </span>water<span> into</span>water<span> vapor in the </span>atmosphere<span>. Plants, too, help </span>water<span> get into the </span>atmosphere<span> through a process called transpiration</span>
4 0
3 years ago
Read 2 more answers
Making a protein from the mRNA template is called what?
charle [14.2K]
MRNA directs protein synthesis with the assistance of tRNA is called translation.

not sure what u are talking abt so I got another answer

The type of RNA that contains the information for making a protein is called messanger RNA (mRNA) because it carries the information, or message, from the DNA out of the nucleus into the cytoplasm.

u choose, or if it's neither...
7 0
3 years ago
In a certain species of plant, the allele to produce green melons (G) is dominant over the allele to produce yellow melons (g).
marishachu [46]

Answer:

4.26

Explanation:

Let the green-melon parents be Gg, then we expect the cross with the yellow-melon plant gg so as to produce 50% Gg and other 50% of gg offspring. What we observed was that 53 green and a 41 yellow. Based on the total number of 94 offspring , we expected half and a half ratios to be 47 of each color.

                                Observed(o)   Expected(e)   (o-e)    $(o-e)^2$      $(o-e)^2/e$

Green-melon plant        53                    47               6          36             0.766

Yellow-melon plant        41                    47              -6          36             0.766

Therefore the chi-square value is 1.53 which is less than the critical value of 3.84. Therefore, the null hypothesis is accepted.

4 0
3 years ago
Capturing energy is critical to
Y_Kistochka [10]

Answer:

C. reproduce

Explanation:

8 0
3 years ago
Other questions:
  • A patient arrives in the emergency department under the influence of cyanide and has been unconscious for more than an hour. whi
    7·1 answer
  • Testing Two-Point Discrimination
    8·1 answer
  • How can dna be used to help solve a crime
    13·2 answers
  • trees that are installed individually or in small numbers to provide an eye- catching contrast to the more numerous background t
    15·1 answer
  • What is produced by the end of the cell cycle? one parent and two daughter cells one large mature parent cell two identical daug
    5·2 answers
  • In your own words, how can nuclear power be a much better option than a fossil fuel one?
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What are two organelles that all cells (prokaryotes AND eukaryotes) have?
    5·1 answer
  • Please help me I have no idea what it is
    10·1 answer
  • Animals adapting to be nocturnal
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!