1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastasy [175]
3 years ago
13

The pyruvate dehydrogenase complex catalyzes the oxidative decarboxylation of pyruvate to form acetyl‑CoA. E 1 , E 2 , and E 3 a

re abbreviations for the enzymes of the complex. Classify the enzyme names, prosthetic groups, and reactions as E 1 , E 2 , or E 3 .
Biology
1 answer:
FinnZ [79.3K]3 years ago
7 0

Answer:

E1: Pyruvate dehydrogenase, TPP, oxidative decarboxylation reaction

E2: Dihydrolipoyl transacetylase, Lipoamide and Co-enzyme A, transacetylation reaction.

E3: Dihydrolipoyl dehydrogenase, FAD and NAD+, oxidation reaction

Explanation:

Pyruvate dehydrogenase is a multi-enzyme complex with 5 co-enzymes and 3 apo-enzymes:

Pyruvate dehydrogenase (E1) , which uses thiamine pyrophosphate (TPP) as as co-enzymes to catalyze oxidative decarboxylation of pyruvate to hydroxyethyl-TPP.

Dihydrolipoyl transacetylase (E2): which uses lipoamide and coenzyme A as co-enzymes to catalyse the transacetylation from TPP to Lipoamide to form acetyl lipoamide.

Dihydrolipoyl dehydrogenase (E3)​​ which uses FAD and NAD+ as co-enzymes to catalyze the oxidation of lipoamide

You might be interested in
Rays of the sun hitting your face. is it potential energy kinetic energy or both
kiruha [24]

Answer:Radiant energy is a form of kinetic energy so it is Kinetic energy .

8 0
2 years ago
What are the strengths and limations of your model
Galina-37 [17]
Models are used to stimulate reality and make predictions
3 0
3 years ago
What element does your model represent?
AfilCa [17]

Answer:

I guess photosythesis

Explanation:

6 0
2 years ago
The head of a human offspring turns down and prepares to enter the birth canal during ________
masya89 [10]
If I am correct it is The Third Trimester
4 0
3 years ago
Read 2 more answers
What would win in a fight? A Grizzly Bear or a Silverback Gorilla?
vazorg [7]

Not that that would ever happen, but most likely a Gorilla due to strength.

8 0
3 years ago
Other questions:
  • Which characteristics are always present in all living organisms? -Movement -Heredity -Reproduction -Homeostasis -Sensitivity -M
    15·1 answer
  • The fact that some people enjoy skydiving while others regard it as terrifying, shows that
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Each cell must produce only a subset of the genes that are being expressed. This subset is what differentiates one cell from ano
    7·1 answer
  • Categorize the examples of competition between organisms as interspecific or intraspecific.
    8·2 answers
  • What is necessary for a cell to pass the g2 checkpoint?
    11·1 answer
  • BRAINLIESTTTT ASAP!!!
    8·1 answer
  • Help! This question is nowhere in the internet!
    5·1 answer
  • The answer please answer will give brainliest
    8·2 answers
  • Which foods would contain mostly unsaturated fats
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!