1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elodia [21]
4 years ago
12

Which of the following is not a direct fate of the energy flowing through photosynthesis? a. carnivores b. cellular respiration

c. herbivores d. heat sinks
Biology
2 answers:
EastWind [94]4 years ago
7 0

Answer:

The correct answer is a. carnivores.

Photosynthesis is the process by which plants make their food from carbon dioxide and water in the presence of sunlight and chlorophyll. Hence, they convert light energy into chemical energy (food or glucose).

This energy is first utilized in the cellular respiration and then the rest in transferred to the primary consumers i.e. herbivores which feed on green plants.

They use this energy in their metabolic processes. The rest is transferred to the secondary consumers i.e. carnivores which feed on the herbivores.

Hence, energy from the photosynthesis indirectly passes to the carnivores via herbivores.

Aleksandr-060686 [28]4 years ago
6 0
Carnivores among the following choices is not a direct fate of the energy flowing through photosynthesis. The correct option among all the options that are given in the question is the first option or option "a". It is basically neither transmitted or absorbed or reflected. I hope the answer comes to your help.
You might be interested in
Higher temperatures effect sea level
Margaret [11]

Answer:

okay thanks for the you don't mind if

4 0
3 years ago
Which organelle packages the material used to build the cell plate in plant cells
Paul [167]
Its actually the golgi bodies rhat packages and exports important nesecities throughout the cell
8 0
4 years ago
Once assembled, what is the key to a protein's unique function?​
Airida [17]

Answer:

Once assembled, what is the key to a protein's unique function? The manner in which proteins fold is the key to their function

7 0
3 years ago
While asleep, your heart keeps beating, you breathe in and out, your food is being digested, and you are making waste. What part
garri49 [273]

Answer:

I believe that it is the brain stem

Explanation:

The brain stem, at the bottom of the brain, connects the cerebrum with the spinal cord. It includes the midbrain, the pons, and the medulla. It controls fundamental body functions such as breathing, eye movements, blood pressure, heartbeat, and swallowing.

4 0
3 years ago
what is the difference between plant and animal cells ? a .an animal cell can produce energy ,because it has mitochondria . b. a
shusha [124]

Answer: plant cell makes its own food using energy from the sun however animals cells help make their own baby and have a cell wall

5 0
4 years ago
Other questions:
  • Cellular respiration is the process by which energy is stored in the ___ of organic molecules
    12·1 answer
  • Which are factors of rock types that affect the rate of weathering?
    7·2 answers
  • 5 ejemplos de punto de ebullicion
    14·1 answer
  • Which of these is true for a daughter cell produced by mitosis?
    8·2 answers
  • The Galapagos finch species are an exmple of
    15·1 answer
  • Nucleic acids are biological polymers that are comprised of nucleotide monomers covalently bonded together.
    10·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Si una población crece mucho otra vez después de un cuello de botella con el paso del tiempo aumentará diversidad genética ¿por
    12·1 answer
  • How is point source pollution different from nonpoint source pollution?
    5·1 answer
  • Generally, human __________ come in 23 matching pairs Group of answer choices cells genotypes phenotypes chromosomes
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!