1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodomira [7]
3 years ago
7

The mature form of a newly discovered species of eukaryote contains 12 chromosomes and exists in

Biology
1 answer:
Gnesinka [82]3 years ago
3 0

Answer:

12 chromosomes

Explanation:

In mitosis the daughter cells finish up with exactly the same number of chromosomes as the parent cell. This is called the diploid condition where the nucleus of each cell contains a pair of each type of chromosome.

The sister chromatids of each chromosome separate at the centromere forming two distinct daughter cells. The eukaryote has 12 chromosomes and exists in diploid state therefore after mitosis, the number of chromosomes will be retained as that of the parent.

You might be interested in
Which type of precipitation is most likely to form during a thunderstorm?
Vanyuwa [196]

Hello.

The answer: Hail.

Have a nice day

6 0
3 years ago
Read 2 more answers
Which of the following structures is only a part of the male reproductive system in human
TiliK225 [7]
There is no following but it is sperm or testicles
6 0
3 years ago
Why do frogs have triangular heads?<br>Plz help me with this question!!​
trasher [3.6K]

Answer:

Aquatic frogs tend to have long, flat skulls, while digging species often have short skulls with pointed snouts, a shape that also enables them to use their mouths like chopsticks to catch small, scurrying prey such as ants and termites.

Explanation:

8 0
3 years ago
Which statement describes the motion of the water molecules in this situation
elena-14-01-66 [18.8K]

Answer:

im confused, what am i supposed to solve?

Explanation:

im ready to answer, but i dont know what im supposed to solve

4 0
3 years ago
When a beetle dies, how can it be raw material for the plant? (There was no science option so I’m not sure if this is related to
Oliga [24]
The beetle will decompose thus becoming fertilizer for el planto
3 0
3 years ago
Read 2 more answers
Other questions:
  • Letter C represents a wave's _____. A. crest B. trough C. wave height D. wavelength
    6·2 answers
  • 1. Which of the following traits is not characteristic of animals? (1 point) multicellular body structure composed of cells with
    10·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • For those women with a mutation in their BRCA genes, the risk of developing breast cancer by age 50 is as high as _________, whi
    9·1 answer
  • When nerve cells in the nervous system cease to divide, they are in
    5·1 answer
  • A 150 ml bottle of Amoxicillin 250 mg/ml for oral suspension requires the addition of 78 ml of Purified Water to give a 150 ml o
    13·1 answer
  • Which three components are common to all amino acids?
    7·2 answers
  • In a direct fluorescent antibody test, which of the following would we most likely be looking for using a fluorescently-labeled
    9·1 answer
  • Which waterway sees the most trade between the United Kingdom and the rest of Europe?
    8·1 answer
  • 2. Se recomienda que las personas eviten el uso
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!