1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ede4ka [16]
3 years ago
13

The scientific method uses observation and which other process to answer questions?

Biology
2 answers:
katovenus [111]3 years ago
8 0
We could say that there are five steps in scientific method: observation, hypothesis, prediction, experiment and conclusion. Observation is the first step and we could also call it research. In this step we must understand the problem in the right way. The hypothesis is the possible answer, based on the research. Prediction is even more specific than the hypothesis: on this stage, you must know how will you demonstrate that your hypothesis is true. Experiment tests your hypothesis and shows whether your hypothesis was true or false. After that you can proceed to making conclusion, which summarizes the experiment's results, and tells do the results match up to hypothesis and in which way.
Nataly [62]3 years ago
3 0
The scientific method uses these processes:
1. Ask a Testable Question
2. Do Background Research
3. Formulate a Hypothesis
4. Test your Hypothesis by doing an Experiment
5. Analyze your Data and Draw Conclusions



You might be interested in
Eagle Company reported Salaries and Wages Payable of $800 at the beginning of the year and $2,600 at the end of the year. The in
photoshop1234 [79]

Answer:

$55,400

Explanation:

To determine the cash paid for salaries and wages during the year.

wages payable (beginning of the year) = $800

wages payable (end of the year) = $2600

Income statement on wages and salaries for the year = $57,200

cash paid for Salaries and Wages during the year = (Salaries and Wages Expense + wages payable at the beginning of the year) - wages payable at the end of the year

$(57,200 + 800) - $2600

$(58000-2600)

= $55,400

5 0
3 years ago
SCIENCE HELP PLEASE
matrenka [14]

Answer:

camels

some snakes

lizards(some)

roaches

vultures

ravens

giraffas(i seen it before!)

plants:

cactus

Explanation:

ik a lot about animals? also,you didn't compete the questio but, i hope one of these were it! :3

4 0
2 years ago
Read 2 more answers
What are two things involved in a nerve impulse?
V125BC [204]
1. Acceleration of impulse
2. Deceleration of impulse
4 0
3 years ago
Read 2 more answers
How does the phenomena of survive of the fittest relates to peppered moth simulation?
IgorC [24]
Peppered moth stimulation is an experimental setup that show the behavior of moth in relation to their environment. The objective of the setup is to stimulate changes in moth population as a result of pollution and predation. 
Peppered moth stimulation relates to the survival of the fittest because the moth with the most adaptive ability will be able to survive despite the negative forces in the environment. The bright colored moth was able to survive the pollution in the environment and retains its colour while the black coloured moth change its colour to black due to the pollution int the environment.
4 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • About how many cells are made of water
    13·1 answer
  • Identify three structures which provide support and protection in a eukaryotic cell.
    12·2 answers
  • Why are scientists interested in the origin of organic molecules?<br><br> help me please...
    7·1 answer
  • What process accounts for species diversity.
    7·1 answer
  • Without genetic variation, some of the basic mechanisms of evolutionary change cannot operate. Consider the three primary source
    13·1 answer
  • PLEASE HELPPPPP I WILL GIVE BRAINLIEST
    8·1 answer
  • The diatoms have flat geometric shapes and chains so they can increase their surface area. This will help them ? *
    5·1 answer
  • 12.
    8·1 answer
  • True or false: The drug Salvarsan was used as treatment for syphilis in the early twentieth century.
    7·1 answer
  • Which can be left out of a food chain
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!