1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
9

Over long periods of time, tectonic forces can cause rocks to fold. what kind of stress causes folding?

Biology
1 answer:
lakkis [162]3 years ago
8 0
A tension ik it is so a 
You might be interested in
DNA Base Pairing Worksheet
erastovalidia [21]

Answer: 1. CCGTAAGCGCTAGTAC

2.GCAATCGTACGAAGTA

3. TGATTGCCATCGATCG

Explanation: you just flip the letters with their corresponding ones

5 0
3 years ago
1. Where is the CFTR protein found?
maks197457 [2]

Answer:

CFTR protein is found in the cells lining the lungs

5 0
3 years ago
Compare and contrast the structures and functions of DNA, mRNA, and tRNA
navik [9.2K]
In DNA the sugar used is called deoxyribose whereas in RNA the sugar is ribose (hence DNA and RNA). The important structural difference between the two types of RNA is that mRNA takes on the shape of a line whereas tRNA has a clover-like shape.
7 0
3 years ago
Are a group of cells working together to perform one or more specificc <br> functions.
Lana71 [14]

Answer:

That statement described a tissue.

5 0
3 years ago
Which of the following describes a state of equilibrium?
Ber [7]

Answer: My best guess would be B but i might be wrong that sounds most right to me. :)

Explanation:

8 0
3 years ago
Other questions:
  • A researcher who studies neurodegenerative diseases has found that dying neurons contains a high concentration of miss-folded pr
    7·1 answer
  • As scientists research, they often find information that does not fit with current theories. What happens when new, contradictor
    10·1 answer
  • The time period from conception to birth is called
    8·2 answers
  • In the process called ________, species act as agents of natural selection on one another. succession mutualism competition symb
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Is sharpening a pencil a physical or chemical change?
    5·2 answers
  • PLEASE HELP!!!<br> I need a good explanation
    15·2 answers
  • Why do you want to read research by scientists who use the scientific method? Select all that apply.
    6·1 answer
  • F1
    12·2 answers
  • Worth 50 points
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!