1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julsineya [31]
4 years ago
8

Explain how the diaphragm aids in breathing.

Biology
2 answers:
zepelin [54]4 years ago
7 0
The diaphragm is the large dome-shaped muscle that rests right under the lungs and separates the abdominal cavity from the thoracic cavity. The contractions of the diaphragm are what truly facilitate the movement of air in and out of the lungs. The contraction of the diaphragm, or breathing in, leaves more room in the chest cavity for the lungs to expand as the diaphragm "tightens". The expanded lungs are filled with oxygen-rich air which is then is diffused through capillaries to different parts of the body. The process of breathing out occurs when the diaphragm relaxes, slowly resuming its position its original position in the chest cavity. When relaxing, carbon dioxide is forced out of the lungs.

Hope this helped! :)
nalin [4]4 years ago
7 0

During inhalation, the diaphragm contracts and moves downward, increasing the space in the chest cavity. Air is sucked in through the nose and mouth and eventually travels to the lungs, which expand.

During exhalation, the diaphragm relaxes and moves upward, reducing the space in the chest cavity. This forces carbon dioxide out of the lungs through the nose and mouth.

You might be interested in
Suppose you found a fossil of a clam shell what can you conclude about the once-living organism and how it became a fossil?
Stolb23 [73]

Answer:

Identifying the fossil is the first step. We have already identified this fossil as a clamshell. We know clam are from the sea, but if you didn't, you could conclude this from knowing where you found the fossil (likely near the beach). Discovering where it is can also lead you to a conclusion on it's arrival as a fossil, perhaps washed up on shore or buried by an animal.

Explanation:

8 0
3 years ago
Read 2 more answers
Air is made up of different gases, such as oxygen, nitrogen, and carbon dioxide.
evablogger [386]

Answer:

<em>The correct option is A) they are all classified as pure substances.</em>

Explanation:

Pure air is a term which is used to described air which is free from pollutants or other contaminants. All the substance from which air is made are considered as pure substances. Hence, option A is correct.

Other options, like option C, is false because the components of the air are no chemically bonded to one another. They exist freely. Options D is false because not all the components of air can be classified as an element. For example, carbon dioxide is not an element.

5 0
3 years ago
_____ enters the leaf through the stomata. Carbon dioxide Oxygen Sunlight Water
Simora [160]
Stomata allows gas exchange throughout the leaf so your answer is carbon dioxide
: D
7 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
What type of eye protection is required in a lab? a. Lab-grade goggles all the time for anyone working with chemicals b. Lab-gra
Strike441 [17]
It depends on your teacher, it should be A. It could be B if that’s what your teacher wants but I would go with A.
8 0
1 year ago
Read 2 more answers
Other questions:
  • Select all that apply.
    11·2 answers
  • Which hormone, produced by the thyroid gland, works opposite to parathyroid hormone (pth)?
    14·1 answer
  • What is the adjective phrase in this sentence carbohydrates are the body's main source of energy?
    12·1 answer
  • In addition to the elements found in carbohydrates, proteins contain the element nitrogen.
    12·2 answers
  • Which term describes one kind of movement of earth
    8·2 answers
  • A well designed experiment can only have one dependent variable?<br> True<br> False
    10·1 answer
  • True or False? An immature B cell that readily binds to a bone marrow stromal cell will likely exit the bone marrow and migrate
    11·1 answer
  • Some areas of an ocean are known as dead zones. These zones form when excess organic material decomposes. This increased decompo
    14·1 answer
  • Which is the greatest carbon reservoir?<br> A. Geosphere B. Hydrosphere C. Atmosphere D. Biosphere
    10·1 answer
  • Which of the following best describes the importance of the phase of mitosis shown in cell 1?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!