Answer:
Identifying the fossil is the first step. We have already identified this fossil as a clamshell. We know clam are from the sea, but if you didn't, you could conclude this from knowing where you found the fossil (likely near the beach). Discovering where it is can also lead you to a conclusion on it's arrival as a fossil, perhaps washed up on shore or buried by an animal.
Explanation:
Answer:
<em>The correct option is A) they are all classified as pure substances.</em>
Explanation:
Pure air is a term which is used to described air which is free from pollutants or other contaminants. All the substance from which air is made are considered as pure substances. Hence, option A is correct.
Other options, like option C, is false because the components of the air are no chemically bonded to one another. They exist freely. Options D is false because not all the components of air can be classified as an element. For example, carbon dioxide is not an element.
Stomata allows gas exchange throughout the leaf so your answer is carbon dioxide
: D
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
It depends on your teacher, it should be A. It could be B if that’s what your teacher wants but I would go with A.