All categories

3 years ago

A mudflow consists of debris with a large amount of

1 answer:

6 0

Hii Mate____ ^_^
.
.
.
.
here's your answer___⤵

♦A mudflow consists of debris with a large amount of partially or fully liquified by the addition of significant amounts of water to the source material.
.
_____
HOPE IT HELPS!!☺
MARK AS BRAINLIEST PLEASE

You might be interested in

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

I need help with number two an 3 I already did one brainliest badge

Serhud [2]

I’m not sure if you got the wrong number

6 0

2 years ago

Read 2 more answers

What Is Chemogeny ( Chemical Evolution ) ? And Explain The Steps Of Chemogeny [Both Answer In Simple Word/ Simple Answer Which I

solniwko [45]

Answer:

Chemogeny may be a theory of chemical evolution that depends on the chemical reactions and formation of drugs on the bases of chemical reactions. This theory says that “Life occurs as a results of evolution of inorganic matter”.

In the 1920's Scientists Oparin and Haldane, developed this hypothesis of the chemical origin of life from the primitive atmosphere of the world having matter like methane, ammonia and water. there have been very low concentrations of oxygen thanks to the presence of high temperatures like 5000-60000C. So, these conditions weren't suitable for the free existence of organic compounds, so reactions started happening .

Under conditions like high sunlight and warmth , inorganic matter gets converted to inorganic compounds. And this might end in the storage of organic compounds, which gets more and more concentrated with the passage of many years.

These compounds interact with one another and end in “life”.

So, chemogeny is that the process of chemical evolution of earth and formation of life from pre-existing matter with the assistance of chemical reactions.

Explanation:

Hopefully I was able to help you with the concept. Good luck!

8 0

3 years ago

Read 2 more answers

How are the protists with flagella similar to the protists with cilia?

PilotLPTM [1.2K]

Flagella and cilia are both used for movement

6 0

3 years ago

What situation is an example of artifical selection?

timofeeve [1]

I believe it is D. More African elephants today naturally lack tusks compared to the elephant populations 100 years ago, because big game hunters sought elephants for ivory.

8 0

3 years ago

Read 2 more answers