Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Most reasonable answer is the swallowable camera one. mris and cat scans were invented in the 70s and the rest of the answers are around the 1800s or before.
The answer would be c. only plant cells and some single cell organisms photosynthesize.
Since this is college level biology, you should know that red blood cells do not contain organelles... therefore it does not do a,c, and d. So, the question should say, which of the following is correct.
So sound travels 1 kilometer in roughly 3 seconds and 1 mile in roughly 5 seconds. When you see the flash of a lightning bolt, you can start counting seconds and then divide to see how far away the lightning struck.
Answer:
a and d is in woody and herbaceous stems
Explanation:
hope this helps
