1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ohaa [14]
3 years ago
9

List the three components of a scientific argument, describing each in a few words.

Biology
2 answers:
Kay [80]3 years ago
8 0
The three components of a scientific argument are Scientific Idea, Expectation and Observation. The Scientific idea generate expectation,  expectations results to observation and the last is relevant to those expectations form what we call scientific argument.
storchak [24]3 years ago
5 0

Answer: Claim- a conclusion or explanation

Evedence- data supporting the claim

Reasoning- logic that ties claim and evidence

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
A few of the presenters in the course discussed the three steps toward reducing our dependence on fossil fuels. These steps shou
Alisiya [41]

Answer:

I got a new car

Explanation:

4 0
3 years ago
How are consumers and producers similar?
stealth61 [152]
They both need nutrients to carry out life functions
4 0
2 years ago
6. What is the name of the mutation in which a base is added to the<br> genetic sequence?<br> shift
Oxana [17]

Answer: frameshift mutation

Explanation: A frameshift mutation is a particular type of mutation that involves either insertion or deletion of extra bases of DNA. Now, what's important here is the number three. The number of bases that are either added or subtracted can't be divisible by three.

4 0
2 years ago
HELPP PLEASE!!! I’ll MARK YOU IF YOU ANSWER PLEASE
Scorpion4ik [409]

Answer:

Explanation:

Studying history enables us to develop better understanding of the world in which we live. Building knowledge and understanding of historical events and trends, especially over the past century, enables us to develop a much greater appreciation for current events today.

hope thats what your looking for

6 0
3 years ago
Other questions:
  • Complains of a dry mouth. the medical term for this condition is
    6·1 answer
  • What organs or structures in the body (other than the urinary system) help you maintain a water balance? explain?
    5·1 answer
  • It is best to avoid serving cow's milk until the infant reaches the age of ________.
    10·1 answer
  • How does the body react when the outside temperature gets too hot?
    6·1 answer
  • Four reasons why the indigenous tuli breed would be superior to exotic breeds
    12·1 answer
  • ) during dark adaptation ________.
    8·1 answer
  • What might be an advantage of a simple population of animals having a large amount of variability surrounding certain traits
    11·1 answer
  • Which is true about molecules entering a cell?
    5·1 answer
  • Why should wilderness designation and management consider adjacent land uses? A) because activities in adjacent lands can direct
    15·1 answer
  • The vegetation in a region is removed in an area so that electrical lines from a new power plant can be built. What is a likely
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!